Construct: ORF TRCN0000478308
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF011252.2_s317c1
- Derived from:
- ccsbBroadEn_07723
- DNA Barcode:
- ATCGACTTCGATGCCTGGACTCCC
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- LILRB4 (11006)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000478308
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 11006 | LILRB4 | leukocyte immunoglobulin li... | NM_001278426.3 | 99.8% | 99.7% | 58C>G;459T>C |
| 2 | human | 11006 | LILRB4 | leukocyte immunoglobulin li... | NM_001278427.3 | 99.6% | 99.5% | 58C>G;459T>C;1040_1041insGCA |
| 3 | human | 11006 | LILRB4 | leukocyte immunoglobulin li... | NM_001278428.3 | 99.4% | 99.1% | (many diffs) |
| 4 | human | 11006 | LILRB4 | leukocyte immunoglobulin li... | XM_017026215.1 | 91.2% | 91% | (many diffs) |
| 5 | human | 11006 | LILRB4 | leukocyte immunoglobulin li... | XM_024451331.1 | 91.2% | 91.2% | (many diffs) |
| 6 | human | 11006 | LILRB4 | leukocyte immunoglobulin li... | XM_017026216.1 | 91% | 90.8% | (many diffs) |
| 7 | human | 11006 | LILRB4 | leukocyte immunoglobulin li... | XM_017026217.1 | 91% | 91% | (many diffs) |
| 8 | human | 11006 | LILRB4 | leukocyte immunoglobulin li... | NM_001278429.3 | 88.9% | 88.7% | (many diffs) |
| 9 | human | 107987462 | LOC107987462 | leukocyte immunoglobulin-li... | XM_017030298.1 | 60.4% | 51.7% | (many diffs) |
| 10 | human | 102725035 | LOC102725035 | leukocyte immunoglobulin-li... | XM_011548574.3 | 60.3% | 51.9% | (many diffs) |
| 11 | human | 107987462 | LOC107987462 | leukocyte immunoglobulin-li... | XM_017030299.1 | 60.3% | 51.7% | (many diffs) |
| 12 | human | 107987425 | LOC107987425 | leukocyte immunoglobulin-li... | XM_011547050.2 | 60.2% | 52% | (many diffs) |
| 13 | human | 11025 | LILRB3 | leukocyte immunoglobulin li... | XM_011526381.2 | 60.2% | 51.9% | (many diffs) |
| 14 | human | 102725035 | LOC102725035 | leukocyte immunoglobulin-li... | XM_011548575.3 | 60.2% | 51.9% | (many diffs) |
| 15 | human | 107987425 | LOC107987425 | leukocyte immunoglobulin-li... | XM_011547051.3 | 60.1% | 52% | (many diffs) |
| 16 | human | 11025 | LILRB3 | leukocyte immunoglobulin li... | NM_001320960.2 | 60.1% | 51.9% | (many diffs) |
| 17 | human | 107987425 | LOC107987425 | leukocyte immunoglobulin-li... | XM_011547058.2 | 60% | 52% | (many diffs) |
| 18 | human | 11025 | LILRB3 | leukocyte immunoglobulin li... | XM_011526382.2 | 60% | 51.8% | (many diffs) |
| 19 | human | 107987462 | LOC107987462 | leukocyte immunoglobulin-li... | XM_017030296.1 | 58.4% | 50.3% | (many diffs) |
| 20 | human | 11025 | LILRB3 | leukocyte immunoglobulin li... | XM_017026219.1 | 58.4% | 50.2% | (many diffs) |
| 21 | human | 11025 | LILRB3 | leukocyte immunoglobulin li... | XM_017026218.1 | 58.4% | 50.1% | (many diffs) |
| 22 | human | 107987462 | LOC107987462 | leukocyte immunoglobulin-li... | XM_017030297.1 | 58.3% | 50.3% | (many diffs) |
| 23 | human | 11025 | LILRB3 | leukocyte immunoglobulin li... | XM_017026221.1 | 58.3% | 50.2% | (many diffs) |
| 24 | human | 102725035 | LOC102725035 | leukocyte immunoglobulin-li... | XM_006726313.4 | 58.3% | 50.3% | (many diffs) |
| 25 | human | 11025 | LILRB3 | leukocyte immunoglobulin li... | XM_017026220.1 | 58.2% | 50.1% | (many diffs) |
| 26 | human | 107987425 | LOC107987425 | leukocyte immunoglobulin-li... | XM_006726278.2 | 58.2% | 50.5% | (many diffs) |
| 27 | human | 11025 | LILRB3 | leukocyte immunoglobulin li... | NM_001081450.3 | 58.2% | 50.3% | (many diffs) |
| 28 | human | 102725035 | LOC102725035 | leukocyte immunoglobulin-li... | XM_006726314.4 | 58.2% | 50.3% | (many diffs) |
| 29 | human | 10859 | LILRB1 | leukocyte immunoglobulin li... | NM_001081637.2 | 58.2% | 48.6% | (many diffs) |
| 30 | human | 107987425 | LOC107987425 | leukocyte immunoglobulin-li... | XM_006726280.2 | 58.1% | 50.5% | (many diffs) |
| 31 | human | 11025 | LILRB3 | leukocyte immunoglobulin li... | NM_006864.4 | 58.1% | 50.3% | (many diffs) |
| 32 | human | 10859 | LILRB1 | leukocyte immunoglobulin li... | NM_001081638.3 | 58% | 48.4% | (many diffs) |
| 33 | human | 10859 | LILRB1 | leukocyte immunoglobulin li... | NM_001081639.3 | 58% | 48.4% | (many diffs) |
| 34 | human | 10859 | LILRB1 | leukocyte immunoglobulin li... | XM_017026182.2 | 57.4% | 47.9% | (many diffs) |
| 35 | human | 10859 | LILRB1 | leukocyte immunoglobulin li... | XM_011526331.2 | 57.3% | 47.8% | (many diffs) |
| 36 | human | 10859 | LILRB1 | leukocyte immunoglobulin li... | XM_017026183.2 | 57.2% | 47.8% | (many diffs) |
| 37 | human | 10859 | LILRB1 | leukocyte immunoglobulin li... | XM_011526332.3 | 57.1% | 47.7% | (many diffs) |
| 38 | human | 10859 | LILRB1 | leukocyte immunoglobulin li... | XM_017026186.1 | 56.7% | 47.3% | (many diffs) |
| 39 | human | 10859 | LILRB1 | leukocyte immunoglobulin li... | XM_017026187.1 | 56.7% | 47.3% | (many diffs) |
| 40 | human | 11006 | LILRB4 | leukocyte immunoglobulin li... | NM_001278430.3 | 56.5% | 56.2% | (many diffs) |
| 41 | human | 11025 | LILRB3 | leukocyte immunoglobulin li... | XM_017026222.1 | 56.4% | 48.6% | (many diffs) |
| 42 | human | 11025 | LILRB3 | leukocyte immunoglobulin li... | XM_017026223.1 | 56.3% | 48.6% | (many diffs) |
| 43 | human | 10859 | LILRB1 | leukocyte immunoglobulin li... | NM_001278398.2 | 56.3% | 47.5% | (many diffs) |
| 44 | human | 10990 | LILRB5 | leukocyte immunoglobulin li... | XM_011526359.2 | 54.9% | 46.2% | (many diffs) |
| 45 | human | 10990 | LILRB5 | leukocyte immunoglobulin li... | XM_011526361.2 | 53% | 44.8% | (many diffs) |
| 46 | human | 11006 | LILRB4 | leukocyte immunoglobulin li... | XR_002958246.1 | 52.3% | (many diffs) | |
| 47 | human | 11025 | LILRB3 | leukocyte immunoglobulin li... | XM_024451332.1 | 52% | 45.1% | (many diffs) |
| 48 | human | 102725035 | LOC102725035 | leukocyte immunoglobulin-li... | XR_001756785.2 | 49.6% | (many diffs) | |
| 49 | human | 107987425 | LOC107987425 | leukocyte immunoglobulin-li... | XR_952182.3 | 49.6% | (many diffs) | |
| 50 | human | 107987462 | LOC107987462 | leukocyte immunoglobulin-li... | XR_001756804.1 | 49.1% | (many diffs) | |
| 51 | human | 107987441 | LOC107987441 | leukocyte immunoglobulin-li... | XM_017030292.1 | 49.1% | 41.7% | (many diffs) |
| 52 | human | 112268334 | LOC112268334 | leukocyte immunoglobulin-li... | XM_024452538.1 | 49.1% | 41.7% | (many diffs) |
| 53 | human | 112268336 | LOC112268336 | leukocyte immunoglobulin-li... | XM_024452546.1 | 49.1% | 41.7% | (many diffs) |
| 54 | human | 112268337 | LOC112268337 | leukocyte immunoglobulin-li... | XM_024452551.1 | 49.1% | 41.7% | (many diffs) |
| 55 | human | 112268340 | LOC112268340 | leukocyte immunoglobulin-li... | XM_024452562.1 | 49.1% | 41.7% | (many diffs) |
| 56 | human | 11025 | LILRB3 | leukocyte immunoglobulin li... | NR_135495.2 | 41.6% | (many diffs) | |
| 57 | human | 102725035 | LOC102725035 | leukocyte immunoglobulin-li... | XR_001756784.2 | 41.2% | (many diffs) | |
| 58 | human | 11025 | LILRB3 | leukocyte immunoglobulin li... | NR_135493.2 | 40.1% | (many diffs) | |
| 59 | human | 11025 | LILRB3 | leukocyte immunoglobulin li... | NR_135494.2 | 40.1% | (many diffs) | |
| 60 | human | 11025 | LILRB3 | leukocyte immunoglobulin li... | NR_135496.2 | 39.3% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1410
- ORF length:
- 1344
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgat ccccaccttc acggctctgc tctgcctcgg gctgagtctg ggccccagga 121 ccgacatgca ggcagggccc ctccccaaac ccaccctctg ggctgagcca ggctctgtga 181 tcagctgggg gaactctgtg accatctggt gtcaggggac cctggaggct cgggagtacc 241 gtctggataa agaggaaagc ccagcaccct gggacagaca gaacccactg gagcccaaga 301 acaaggccag attctccatc ccatccatga cagaggacta tgcagggaga taccgctgtt 361 actatcgcag ccctgtaggc tggtcacagc ccagtgaccc cctggagctg gtgatgacag 421 gagcctacag taaacccacc ctttcagccc tgccgagtcc tcttgtgacc tcaggaaaga 481 gcgtgaccct gctgtgtcag tcacggagcc caatggacac tttccttctg atcaaggagc 541 gggcagccca tcccctactg catctgagat cagagcacgg agctcagcag caccaggctg 601 aattccccat gagtcctgtg acctcagtgc acggggggac ctacaggtgc ttcagctcac 661 acggcttctc ccactacctg ctgtcacacc ccagtgaccc cctggagctc atagtctcag 721 gatccttgga gggtcccagg ccctcaccca caaggtccgt ctcaacagct gcaggccctg 781 aggaccagcc cctcatgcct acagggtcag tcccccacag tggtctgaga aggcactggg 841 aggtactgat cggggtcttg gtggtctcca tcctgcttct ctccctcctc ctcttcctcc 901 tcctccaaca ctggcgtcag ggaaaacaca ggacattggc ccagagacag gctgatttcc 961 aacgtcctcc aggggctgcc gagccagagc ccaaggacgg gggcctacag aggaggtcca 1021 gcccagctgc tgacgtccag ggagaaaact tctgtgctgc cgtgaagaac acacagccTG 1081 AGGACGGGGT GGAAATGGAC ACTCGGCAGA GCCCACACGA TGAAGACCCC CAGGCAGTGA 1141 CGTATGCCAA GGTGAAACAC TCCAGACCTA GGAGAGAAAT GGCCTCTCCT CCCTCCCCAC 1201 TGTCTGGGGA ATTCCTGGAC ACAAAGGACA GACAGGCAGA AGAGGACAGA CAGATGGACA 1261 CTGAGGCTGC TGCATCTGAA GCCCCCCAGG ATGTGACCTA CGCCCGGCTG CACAGCTTTA 1321 CCCTCAGACA GAAGGCAACT GAGCCTCCTC CATCCCAGGA AGGGGCCTCT CCAGCTGAGC 1381 CCAGTGTCTA TGCCACTCTG GCCATCCACT ACCCAACTTT CTTGTACAAA GTGGTTGATA 1441 TCGGTAAGCC TATCCCTAAC CCTCTCCTCG GTCTCGATTC TACGTAGTAA TGAACTAGTC 1501 CGTAACTTGA AAGTATTTCG ATTTCTTGGC TTTATATATC TTGTGGAAAG GACGAATCGA 1561 CTTCGATGCC TGGACTCCCA CGCGTTAAGT Cgacaatcaa cctctggatt acaaaatttg 1621 tgaaagatt