Construct: ORF TRCN0000476797
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF002246.1_s317c1
- Derived from:
- ccsbBroadEn_11582
- DNA Barcode:
- GACTTACTCCCCGGATCTCGTAGG
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- LILRB3 (11025)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000476797
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
---|---|---|---|---|---|---|---|---|
1 | human | 102725035 | LOC102725035 | leukocyte immunoglobulin-li... | XM_006726314.4 | 99.9% | 99.8% | 863C>G |
2 | human | 102725035 | LOC102725035 | leukocyte immunoglobulin-li... | XM_006726313.4 | 99.7% | 99.6% | 863C>G;1591_1593delCAG |
3 | human | 107987462 | LOC107987462 | leukocyte immunoglobulin-li... | XM_017030297.1 | 98.8% | 97.7% | (many diffs) |
4 | human | 107987425 | LOC107987425 | leukocyte immunoglobulin-li... | XM_006726280.2 | 98.7% | 97.6% | (many diffs) |
5 | human | 107987462 | LOC107987462 | leukocyte immunoglobulin-li... | XM_017030296.1 | 98.6% | 97.6% | (many diffs) |
6 | human | 11025 | LILRB3 | leukocyte immunoglobulin li... | NM_006864.4 | 98.6% | 97.3% | (many diffs) |
7 | human | 107987425 | LOC107987425 | leukocyte immunoglobulin-li... | XM_006726278.2 | 98.6% | 97.4% | (many diffs) |
8 | human | 11025 | LILRB3 | leukocyte immunoglobulin li... | NM_001081450.3 | 98.5% | 97.1% | (many diffs) |
9 | human | 102725035 | LOC102725035 | leukocyte immunoglobulin-li... | XM_011548575.3 | 97.3% | 97.2% | 863C>G;1308_1358del |
10 | human | 102725035 | LOC102725035 | leukocyte immunoglobulin-li... | XM_011548574.3 | 97.1% | 97% | 863C>G;1308_1358del;1642_1644delCAG |
11 | human | 11025 | LILRB3 | leukocyte immunoglobulin li... | XM_017026223.1 | 96.8% | 95.5% | (many diffs) |
12 | human | 11025 | LILRB3 | leukocyte immunoglobulin li... | XM_017026222.1 | 96.6% | 95.4% | (many diffs) |
13 | human | 107987462 | LOC107987462 | leukocyte immunoglobulin-li... | XM_017030299.1 | 96.2% | 95.2% | (many diffs) |
14 | human | 107987425 | LOC107987425 | leukocyte immunoglobulin-li... | XM_011547051.3 | 96.1% | 95% | (many diffs) |
15 | human | 107987462 | LOC107987462 | leukocyte immunoglobulin-li... | XM_017030298.1 | 96% | 95% | (many diffs) |
16 | human | 11025 | LILRB3 | leukocyte immunoglobulin li... | NM_001320960.2 | 96% | 94.7% | (many diffs) |
17 | human | 107987425 | LOC107987425 | leukocyte immunoglobulin-li... | XM_011547050.2 | 96% | 94.9% | (many diffs) |
18 | human | 107987425 | LOC107987425 | leukocyte immunoglobulin-li... | XM_011547058.2 | 96% | 94.7% | (many diffs) |
19 | human | 11025 | LILRB3 | leukocyte immunoglobulin li... | XM_011526381.2 | 95.9% | 94.6% | (many diffs) |
20 | human | 11025 | LILRB3 | leukocyte immunoglobulin li... | XM_011526382.2 | 95.9% | 94.4% | (many diffs) |
21 | human | 11025 | LILRB3 | leukocyte immunoglobulin li... | XM_017026221.1 | 94.2% | 93% | (many diffs) |
22 | human | 11025 | LILRB3 | leukocyte immunoglobulin li... | XM_017026219.1 | 94.1% | 92.9% | (many diffs) |
23 | human | 11025 | LILRB3 | leukocyte immunoglobulin li... | XM_017026220.1 | 94.1% | 92.7% | (many diffs) |
24 | human | 11025 | LILRB3 | leukocyte immunoglobulin li... | XM_017026218.1 | 94% | 92.6% | (many diffs) |
25 | human | 11025 | LILRB3 | leukocyte immunoglobulin li... | XM_024451332.1 | 87.9% | 86.5% | (many diffs) |
26 | human | 102725035 | LOC102725035 | leukocyte immunoglobulin-li... | XR_001756785.2 | 84.7% | (many diffs) | |
27 | human | 107987425 | LOC107987425 | leukocyte immunoglobulin-li... | XR_952182.3 | 83.7% | (many diffs) | |
28 | human | 107987462 | LOC107987462 | leukocyte immunoglobulin-li... | XR_001756804.1 | 82.6% | (many diffs) | |
29 | human | 10990 | LILRB5 | leukocyte immunoglobulin li... | XM_011526361.2 | 81.3% | 71.2% | (many diffs) |
30 | human | 10990 | LILRB5 | leukocyte immunoglobulin li... | XM_011526360.2 | 79.4% | 69.5% | (many diffs) |
31 | human | 10990 | LILRB5 | leukocyte immunoglobulin li... | XM_011526359.2 | 79.3% | 69.4% | (many diffs) |
32 | human | 10990 | LILRB5 | leukocyte immunoglobulin li... | NM_001304457.2 | 78.3% | 68.5% | (many diffs) |
33 | human | 10990 | LILRB5 | leukocyte immunoglobulin li... | NM_006840.5 | 75.1% | 64.9% | (many diffs) |
34 | human | 10990 | LILRB5 | leukocyte immunoglobulin li... | NM_001081442.3 | 75% | 64.8% | (many diffs) |
35 | human | 102725035 | LOC102725035 | leukocyte immunoglobulin-li... | XR_001756784.2 | 74.9% | (many diffs) | |
36 | human | 11025 | LILRB3 | leukocyte immunoglobulin li... | XR_001753596.1 | 74.5% | (many diffs) | |
37 | human | 79168 | LILRA6 | leukocyte immunoglobulin li... | NM_001360167.1 | 72.4% | 69.2% | (many diffs) |
38 | human | 79168 | LILRA6 | leukocyte immunoglobulin li... | NM_024318.4 | 72.3% | 69% | (many diffs) |
39 | human | 79168 | LILRA6 | leukocyte immunoglobulin li... | XM_011547130.2 | 70.2% | 66.4% | (many diffs) |
40 | human | 10990 | LILRB5 | leukocyte immunoglobulin li... | XM_011526362.2 | 67.4% | 59.4% | (many diffs) |
41 | human | 11025 | LILRB3 | leukocyte immunoglobulin li... | NR_135493.2 | 67.4% | (many diffs) | |
42 | human | 11025 | LILRB3 | leukocyte immunoglobulin li... | NR_135495.2 | 65.3% | (many diffs) | |
43 | human | 11025 | LILRB3 | leukocyte immunoglobulin li... | NR_135496.2 | 65.1% | (many diffs) | |
44 | human | 79168 | LILRA6 | leukocyte immunoglobulin li... | NR_104098.2 | 64.4% | (many diffs) | |
45 | human | 11025 | LILRB3 | leukocyte immunoglobulin li... | NR_135494.2 | 63.2% | (many diffs) | |
46 | human | 10990 | LILRB5 | leukocyte immunoglobulin li... | NM_001081443.3 | 62.6% | 54.3% | (many diffs) |
47 | human | 10288 | LILRB2 | leukocyte immunoglobulin li... | NM_001278404.2 | 60.1% | 53.2% | (many diffs) |
48 | human | 11006 | LILRB4 | leukocyte immunoglobulin li... | NM_001278427.3 | 58.2% | 50.3% | (many diffs) |
49 | human | 11006 | LILRB4 | leukocyte immunoglobulin li... | NM_001278426.3 | 58.2% | 50.3% | (many diffs) |
50 | human | 11006 | LILRB4 | leukocyte immunoglobulin li... | NM_001278428.3 | 58.1% | 50.2% | (many diffs) |
51 | human | 11006 | LILRB4 | leukocyte immunoglobulin li... | NM_001278429.3 | 55.5% | 45.8% | (many diffs) |
52 | human | 79168 | LILRA6 | leukocyte immunoglobulin li... | XR_001756516.1 | 55.1% | (many diffs) | |
53 | human | 11006 | LILRB4 | leukocyte immunoglobulin li... | XM_017026217.1 | 54.8% | 47.3% | (many diffs) |
54 | human | 11006 | LILRB4 | leukocyte immunoglobulin li... | XM_024451331.1 | 54.8% | 47.4% | (many diffs) |
55 | human | 11006 | LILRB4 | leukocyte immunoglobulin li... | XM_017026216.1 | 54.7% | 47.3% | (many diffs) |
56 | human | 11006 | LILRB4 | leukocyte immunoglobulin li... | XM_017026215.1 | 54.6% | 47.3% | (many diffs) |
57 | human | 107987441 | LOC107987441 | leukocyte immunoglobulin-li... | XM_017030292.1 | 39.1% | 39% | (many diffs) |
58 | human | 112268334 | LOC112268334 | leukocyte immunoglobulin-li... | XM_024452538.1 | 39.1% | 39% | (many diffs) |
59 | human | 112268336 | LOC112268336 | leukocyte immunoglobulin-li... | XM_024452546.1 | 39.1% | 39% | (many diffs) |
60 | human | 112268337 | LOC112268337 | leukocyte immunoglobulin-li... | XM_024452551.1 | 39.1% | 39% | (many diffs) |
61 | human | 112268340 | LOC112268340 | leukocyte immunoglobulin-li... | XM_024452562.1 | 39.1% | 39% | (many diffs) |
62 | human | 11006 | LILRB4 | leukocyte immunoglobulin li... | NM_001278430.3 | 35.2% | 26.9% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 69
- ORF end:
- 1962
- ORF length:
- 1893
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcaccat gacgcccgcc ctcacagccc tgctctgcct tgggctgagt ctgggcccca 121 ggacccgcgt gcaggcaggg cccttcccca aacccaccct ctgggctgag ccaggctctg 181 tgatcagctg ggggagcccc gtgaccatct ggtgtcaggg gagcctggag gcccaggagt 241 accgactgga taaagaggga agcccagagc ccttggacag aaataaccca ctggaaccca 301 agaacaaggc cagattctcc atcccatcca tgacagagca ccatgcgggg agataccgct 361 gccactatta cagctctgca ggctggtcag agcccagcga ccccctggag ctggtgatga 421 caggattcta caacaaaccc accctctcag ccctgcccag ccctgtggtg gcctcagggg 481 ggaatatgac cctccgatgt ggctcacaga agggatatca ccattttgtt ctgatgaagg 541 aaggagaaca ccagctcccc cggaccctgg actcacagca gctccacagt ggggggttcc 601 aggccctgtt ccctgtgggc cccgtgaacc ccagccacag gtggaggttc acatgctatt 661 actattatat gaacaccccc caggtgtggt cccaccccag tgaccccctg gagattctgc 721 cctcaggcgt gtctaggaag ccctccctcc tgaccctgca gggccctgtc ctggcccctg 781 ggcagagcct gaccctccag tgtggctctg atgtcggcta cgacagattt gttctgtata 841 aggaggggga acgtgacttc ctccagcgcc ctggccagca gccccaggct gggctctccc 901 aggccaactt caccctgggc cctgtgagcc gctcccacgg gggccagtac aggtgctatg 961 gtgcacacaa cctctcctcc gagtggtcgg cccccagcga ccccctgaac atcctgatgg 1021 caggacagat ctatgacacc gtctccctgt cagcacagcc gggccccaca gtggcctcag 1081 gagagaacgt gaccctgctg tgtcagtcat ggtggcagtt tgacactttc cttctgacca 1141 aagaaggggc agcccatccc ccactgcgtc tgagatcaat gtacggagct cataagtacc 1201 aggctgaatt ccccatgagt cctgtgacct cagcccacgc ggggacctac aggtgctacg 1261 gctcatacag ctccaacccc cacctgctgt ctttccccag tgagcccctg gaactcatgg 1321 tctcaggaca ctctggaggc tccagcctcc cacccacagg gccgccctcc acacctggtc 1381 tgggaagata cctggaggtt ttgattgggg tctcggtggc cttcgtcctg ctgctcttcc 1441 tcctcctctt cctcctcctc cgacgtcagc gtcacagcaa acacaggaca tctgaccaga 1501 gaaagactga tttccagcgt cctgcagggg ctgcggagac agagcccaag gacaggggcc 1561 tgctgaggag gtccagccca gctgctgacg tccaggaaga aaacctctat gctgccgtga 1621 aggacacaca gtctgaggac agggtggagc tggacagtca gagcccacac gatgaagacc 1681 cccaggcagt gacgtatgcc ccggtgaaac actccagtcc TAGGAGAGAA ATGGCCTCTC 1741 CTCCCTCCTC ACTGTCTGGG GAATTCCTGG ACACAAAGGA CAGACAGGTG GAAGAGGACA 1801 GGCAGATGGA CACTGAGGCT GCTGCATCTG AAGCCTCCCA GGATGTGACC TACGCCCAGC 1861 TGCACAGCTT GACCCTTAGA CGGAAGGCAA CTGAGCCTCC TCCATCCCAG GAAGGGGAAC 1921 CTCCAGCTGA GCCCAGCATC TACGCCACTC TGGCCATCCA CTTGCCAACT TTCTTGTACA 1981 AAGTGGTTGA TATCGGTAAG CCTATCCCTA ACCCTCTCCT CGGTCTCGAT TCTACGTAGT 2041 AATGAACTAG TCCGTAACTT GAAAGTATTT CGATTTCTTG GCTTTATATA TCTTGTGGAA 2101 AGGACGAGAC TTACTCCCCG GATCTCGTAG GACGCGTTAA GTCgacaatc aacctctgga 2161 ttacaaaatt tgtgaaagat t