Transcript: Human XM_017026433.1

PREDICTED: Homo sapiens single stranded DNA binding protein 4 (SSBP4), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
SSBP4 (170463)
Length:
2191
CDS:
319..1875

Additional Resources:

NCBI RefSeq record:
XM_017026433.1
NBCI Gene record:
SSBP4 (170463)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017026433.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000016383 GCTGTACGTTTATGAGTACCT pLKO.1 384 CDS 100% 2.640 3.696 N SSBP4 n/a
2 TRCN0000353638 AGTTGGCGCTGTACGTTTATG pLKO_005 377 CDS 100% 13.200 17.160 N SSBP4 n/a
3 TRCN0000016387 GCCCTGGAGATTCCACCAACT pLKO.1 1151 CDS 100% 1.350 1.080 N SSBP4 n/a
4 TRCN0000016386 GCCCTTCATGTCACCGCGCTT pLKO.1 753 CDS 100% 0.000 0.000 N SSBP4 n/a
5 TRCN0000329999 GCCCTTCATGTCACCGCGCTT pLKO_005 753 CDS 100% 0.000 0.000 N SSBP4 n/a
6 TRCN0000330030 CCAAGGCCTTCCAGGACTATA pLKO_005 578 CDS 100% 13.200 9.240 N SSBP4 n/a
7 TRCN0000330000 CACGAAAGACTCTTACCATTT pLKO_005 2010 3UTR 100% 10.800 7.560 N SSBP4 n/a
8 TRCN0000330001 TCCGATGGGAGAAGAACATCA pLKO_005 452 CDS 100% 4.950 3.465 N SSBP4 n/a
9 TRCN0000016385 CCGCGAGAAGTTGGCGCTGTA pLKO.1 369 CDS 100% 0.000 0.000 N SSBP4 n/a
10 TRCN0000016384 CGGGACCTTCCTGCACCCGTT pLKO.1 1413 CDS 100% 0.000 0.000 N SSBP4 n/a
11 TRCN0000348499 ATGACCATGAGCGTGTGATAG pLKO_005 1858 CDS 100% 10.800 6.480 N Ssbp4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017026433.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05152 pDONR223 100% 73.9% 72.7% None (many diffs) n/a
2 ccsbBroad304_05152 pLX_304 0% 73.9% 72.7% V5 (many diffs) n/a
3 TRCN0000469420 AAAGTTTCTCCCGTAGGGTCGAAC pLX_317 37.8% 73.9% 72.7% V5 (many diffs) n/a
Download CSV