Transcript: Human XM_017026538.2

PREDICTED: Homo sapiens CREB regulated transcription coactivator 1 (CRTC1), transcript variant X10, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
CRTC1 (23373)
Length:
1490
CDS:
50..1141

Additional Resources:

NCBI RefSeq record:
XM_017026538.2
NBCI Gene record:
CRTC1 (23373)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017026538.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000419707 AGAGTCTTACTGTTAACAGTC pLKO_005 632 CDS 100% 4.050 2.835 N CRTC1 n/a
2 TRCN0000420691 GAATGGAAGAGACCACATCAG pLKO_005 657 CDS 100% 4.050 2.835 N CRTC1 n/a
3 TRCN0000118895 GCTCCAGAAATCCCAGTACCT pLKO.1 181 CDS 100% 2.640 1.848 N CRTC1 n/a
4 TRCN0000074123 CGCCTGTAATCCCAACACTTT pLKO.1 1433 3UTR 100% 4.950 2.475 Y GJD4 n/a
5 TRCN0000166650 CGCCTGTAATCCCAACACTTT pLKO.1 1433 3UTR 100% 4.950 2.475 Y C9orf85 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017026538.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07872 pDONR223 100% 42.2% 34.7% None (many diffs) n/a
2 ccsbBroad304_07872 pLX_304 0% 42.2% 34.7% V5 (many diffs) n/a
3 TRCN0000467955 ACCTGTGTCCAGGGATGACCTATC pLX_317 7.7% 42.2% 34.7% V5 (many diffs) n/a
Download CSV