Transcript: Human XM_017026793.1

PREDICTED: Homo sapiens C-type lectin domain containing 17A (CLEC17A), transcript variant X9, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
CLEC17A (388512)
Length:
1514
CDS:
833..1426

Additional Resources:

NCBI RefSeq record:
XM_017026793.1
NBCI Gene record:
CLEC17A (388512)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017026793.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000119133 GCGAACAAATATGACTGGCAT pLKO.1 1264 CDS 100% 2.640 3.696 N CLEC17A n/a
2 TRCN0000119135 GATTAAGTACCAGGAGTTGAT pLKO.1 1204 CDS 100% 4.950 3.465 N CLEC17A n/a
3 TRCN0000119136 CCTGATTAAGTACCAGGAGTT pLKO.1 1201 CDS 100% 4.050 2.835 N CLEC17A n/a
4 TRCN0000119134 TGAGAACTCAACACCTCCCTA pLKO.1 862 CDS 100% 2.640 1.848 N CLEC17A n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017026793.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_15319 pDONR223 89.3% 52% 15.6% None 0_1ins205;538_539ins152;591_592ins187 n/a
2 ccsbBroad304_15319 pLX_304 0% 52% 15.6% V5 (not translated due to prior stop codon) 0_1ins205;538_539ins152;591_592ins187 n/a
3 TRCN0000477061 TTCACCCTGAAACTCTCCTACTGA pLX_317 32.9% 52% 15.6% V5 (not translated due to prior stop codon) 0_1ins205;538_539ins152;591_592ins187 n/a
Download CSV