Transcript: Human XM_017026836.2

PREDICTED: Homo sapiens nuclear factor I C (NFIC), transcript variant X5, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
NFIC (4782)
Length:
7740
CDS:
34..1293

Additional Resources:

NCBI RefSeq record:
XM_017026836.2
NBCI Gene record:
NFIC (4782)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017026836.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000014710 GCGGCACAAATCGGGCTCGAT pLKO.1 846 CDS 100% 0.000 0.000 N NFIC n/a
2 TRCN0000297065 GCGGCACAAATCGGGCTCGAT pLKO_005 846 CDS 100% 0.000 0.000 N NFIC n/a
3 TRCN0000014709 GATGGACAAGTCACCATTCAA pLKO.1 993 CDS 100% 5.625 3.938 N NFIC n/a
4 TRCN0000277970 GATGGACAAGTCACCATTCAA pLKO_005 993 CDS 100% 5.625 3.938 N NFIC n/a
5 TRCN0000014711 CCCGGTGAAGAAGACAGAGAT pLKO.1 975 CDS 100% 4.950 3.465 N NFIC n/a
6 TRCN0000278027 CCCGGTGAAGAAGACAGAGAT pLKO_005 975 CDS 100% 4.950 3.465 N NFIC n/a
7 TRCN0000014712 CCTCCGCTCTGCATTTCCCTA pLKO.1 1115 CDS 100% 0.880 0.616 N NFIC n/a
8 TRCN0000277967 CCTCCGCTCTGCATTTCCCTA pLKO_005 1115 CDS 100% 0.880 0.616 N NFIC n/a
9 TRCN0000014708 CCACCCAAGCAAGAAGACAAA pLKO.1 1509 3UTR 100% 4.950 2.970 N NFIC n/a
10 TRCN0000297066 CCACCCAAGCAAGAAGACAAA pLKO_005 1509 3UTR 100% 4.950 2.970 N NFIC n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017026836.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06636 pDONR223 100% 97.6% 97.4% None 0_1ins28;2delT;1249T>G n/a
2 ccsbBroad304_06636 pLX_304 0% 97.6% 97.4% V5 0_1ins28;2delT;1249T>G n/a
3 TRCN0000472445 TCGAGCCCCGGTTATTTTCGTCCT pLX_317 38% 97.6% 97.4% V5 0_1ins28;2delT;1249T>G n/a
Download CSV