Transcript: Human XM_017026881.1

PREDICTED: Homo sapiens DNA polymerase delta 1, catalytic subunit (POLD1), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
POLD1 (5424)
Length:
3539
CDS:
147..3470

Additional Resources:

NCBI RefSeq record:
XM_017026881.1
NBCI Gene record:
POLD1 (5424)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017026881.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000007923 CGGTTACAACATCCAGAACTT pLKO.1 1328 CDS 100% 4.950 6.930 N POLD1 n/a
2 TRCN0000342684 CGGTTACAACATCCAGAACTT pLKO_005 1328 CDS 100% 4.950 6.930 N POLD1 n/a
3 TRCN0000007926 GTCCACCTTCATCCGTATCAT pLKO.1 1289 CDS 100% 5.625 3.938 N POLD1 n/a
4 TRCN0000342683 GTCCACCTTCATCCGTATCAT pLKO_005 1289 CDS 100% 5.625 3.938 N POLD1 n/a
5 TRCN0000007927 GCTTATCAGCAAGAAGCGCTA pLKO.1 2552 CDS 100% 2.160 1.512 N POLD1 n/a
6 TRCN0000007925 CCTGCCCATTGACACGCAGTA pLKO.1 2993 CDS 100% 1.350 0.945 N POLD1 n/a
7 TRCN0000352782 CCTGCCCATTGACACGCAGTA pLKO_005 2993 CDS 100% 1.350 0.945 N POLD1 n/a
8 TRCN0000007924 CCTGGCACTGATGGAGGAGAT pLKO.1 257 CDS 100% 1.350 0.945 N POLD1 n/a
9 TRCN0000352781 CCTGGCACTGATGGAGGAGAT pLKO_005 257 CDS 100% 1.350 0.945 N POLD1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017026881.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06747 pDONR223 100% 99.9% 99.9% None 324G>A;356G>A n/a
2 ccsbBroad304_06747 pLX_304 0% 99.9% 99.9% V5 324G>A;356G>A n/a
3 TRCN0000478613 CCCCCTATTCGAATCAAACGGGCT pLX_317 8.2% 99.9% 99.9% V5 324G>A;356G>A n/a
Download CSV