Transcript: Human XM_017026885.2

PREDICTED: Homo sapiens POU class 2 homeobox 2 (POU2F2), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
POU2F2 (5452)
Length:
7399
CDS:
84..2255

Additional Resources:

NCBI RefSeq record:
XM_017026885.2
NBCI Gene record:
POU2F2 (5452)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017026885.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000245327 TCACTGCTACGACGCCAAATA pLKO_005 2601 3UTR 100% 13.200 18.480 N POU2F2 n/a
2 TRCN0000020820 GCACAACAGTTACTACCTTAT pLKO.1 1636 CDS 100% 10.800 15.120 N POU2F2 n/a
3 TRCN0000081521 CTTCGCCTTAGAGAAGAGTTT pLKO.1 1373 CDS 100% 4.950 6.930 N Pou2f2 n/a
4 TRCN0000081520 GAGCACAACAGTTACTACCTT pLKO.1 1634 CDS 100% 3.000 4.200 N Pou2f2 n/a
5 TRCN0000020823 GCTACCGACACCAAATCTATT pLKO.1 860 CDS 100% 13.200 9.240 N POU2F2 n/a
6 TRCN0000245324 GCTACCGACACCAAATCTATT pLKO_005 860 CDS 100% 13.200 9.240 N POU2F2 n/a
7 TRCN0000245326 CAGTCTGAGCACAACAGTTAC pLKO_005 1628 CDS 100% 10.800 7.560 N POU2F2 n/a
8 TRCN0000245323 GAAATGGACCAGACACTAATC pLKO_005 187 CDS 100% 10.800 7.560 N POU2F2 n/a
9 TRCN0000020821 GCACACAGACACCGAAAGAAA pLKO.1 170 CDS 100% 5.625 3.938 N POU2F2 n/a
10 TRCN0000425508 GAGCACACAGACACCGAAAGA pLKO_005 168 CDS 100% 4.950 3.465 N Pou2f2 n/a
11 TRCN0000020822 GCTCAACGATGCAGAGACTAT pLKO.1 1238 CDS 100% 4.950 3.465 N POU2F2 n/a
12 TRCN0000245325 ACTTCAGCCAGACGACCATTT pLKO_005 1150 CDS 100% 10.800 6.480 N POU2F2 n/a
13 TRCN0000020819 CCTCATCCTCTTCATCCTCAT pLKO.1 2149 CDS 100% 4.050 2.430 N POU2F2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017026885.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11047 pDONR223 100% 54.6% 52.2% None (many diffs) n/a
2 ccsbBroad304_11047 pLX_304 42.1% 54.6% 52.2% V5 (many diffs) n/a
3 TRCN0000470280 ATCGGTGCCCCACATGACGGCCCA pLX_317 23.7% 54.6% 52.2% V5 (many diffs) n/a
Download CSV