Transcript: Human XM_017027017.1

PREDICTED: Homo sapiens signal peptide peptidase like 2B (SPPL2B), transcript variant X4, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
SPPL2B (56928)
Length:
3646
CDS:
668..2053

Additional Resources:

NCBI RefSeq record:
XM_017027017.1
NBCI Gene record:
SPPL2B (56928)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017027017.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000073756 CCTGCTCAGCTACAAAGACAT pLKO.1 693 CDS 100% 4.950 3.465 N SPPL2B n/a
2 TRCN0000073753 GCTGGACTACAACATGGTCAT pLKO.1 784 CDS 100% 4.050 2.835 N SPPL2B n/a
3 TRCN0000073757 CGAAGGCAAAGACTACTGCAT pLKO.1 168 5UTR 100% 2.640 1.848 N SPPL2B n/a
4 TRCN0000073755 CCAGCGAAGAACCAGCCACAT pLKO.1 1881 CDS 100% 1.350 0.945 N SPPL2B n/a
5 TRCN0000222567 CGCAGTATGATGAGATTGGCA pLKO.1 662 5UTR 100% 0.750 0.525 N SPPL2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017027017.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08666 pDONR223 100% 77.3% 72.3% None (many diffs) n/a
2 ccsbBroad304_08666 pLX_304 0% 77.3% 72.3% V5 (many diffs) n/a
3 TRCN0000476907 CTGTAACATGGATGGCACTTAAAT pLX_317 19.4% 77.3% 72.3% V5 (many diffs) n/a
4 TRCN0000488595 ACCCGATCCAAGGGTAATGACGTT pLX_317 20% 77.3% 72.3% V5 (not translated due to prior stop codon) (many diffs) n/a
5 TRCN0000488739 GATTGGCCCTAAGCTGTACAACAG pLX_317 63.6% 25.2% 25.3% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV