Transcript: Human XM_017027061.1

PREDICTED: Homo sapiens protein tyrosine phosphatase receptor type H (PTPRH), transcript variant X8, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
PTPRH (5794)
Length:
3402
CDS:
16..2895

Additional Resources:

NCBI RefSeq record:
XM_017027061.1
NBCI Gene record:
PTPRH (5794)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017027061.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000355580 CCAATGAGACGTGGTACAAAG pLKO_005 1421 CDS 100% 10.800 15.120 N PTPRH n/a
2 TRCN0000355578 CCACTCTCAGTTGTACGTATA pLKO_005 1320 CDS 100% 10.800 15.120 N PTPRH n/a
3 TRCN0000355631 GACTGAGGCTCAGTACGTATT pLKO_005 2739 CDS 100% 10.800 15.120 N PTPRH n/a
4 TRCN0000002868 GAGACCCGAAACACAACAAAT pLKO.1 838 CDS 100% 13.200 10.560 N PTPRH n/a
5 TRCN0000355579 GGTGGAGAAAGACGGAGTAAA pLKO_005 381 CDS 100% 13.200 9.240 N PTPRH n/a
6 TRCN0000002866 AGAGGGATGATAGCTTGGATT pLKO.1 3122 3UTR 100% 4.950 3.465 N PTPRH n/a
7 TRCN0000002867 GCGGCACAACAGAGACTCGAA pLKO.1 293 CDS 100% 0.880 0.616 N PTPRH n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017027061.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06818 pDONR223 100% 81.6% 81.1% None (many diffs) n/a
2 ccsbBroad304_06818 pLX_304 0% 81.6% 81.1% V5 (many diffs) n/a
3 TRCN0000481234 GATTGGGCTGAAGACGTCTATATC pLX_317 13.6% 81.6% 81.1% V5 (many diffs) n/a
Download CSV