Transcript: Human XM_017027107.1

PREDICTED: Homo sapiens regulatory factor X2 (RFX2), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
RFX2 (5990)
Length:
3962
CDS:
255..2291

Additional Resources:

NCBI RefSeq record:
XM_017027107.1
NBCI Gene record:
RFX2 (5990)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017027107.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000014843 CCACCAAATTAGTGCCTCTTA pLKO.1 2367 3UTR 100% 4.950 3.465 N RFX2 n/a
2 TRCN0000014846 CGAAGGAATCACATCACACAA pLKO.1 674 CDS 100% 4.950 3.465 N RFX2 n/a
3 TRCN0000014844 GCTCTCCTTCTGGAACTCTAA pLKO.1 1307 CDS 100% 4.950 3.465 N RFX2 n/a
4 TRCN0000014845 GCTGCTCGACAAAGATGACAT pLKO.1 2162 CDS 100% 4.950 3.465 N RFX2 n/a
5 TRCN0000014847 CCAGTTCCACTACATCGAGAA pLKO.1 1280 CDS 100% 4.050 2.835 N RFX2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017027107.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06859 pDONR223 100% 93.7% 93.6% None 0_1ins135;1694G>A n/a
2 ccsbBroad304_06859 pLX_304 30.2% 93.7% 93.6% V5 0_1ins135;1694G>A n/a
3 TRCN0000491438 GGGTTAACCCAGCTTGCTCCGTTC pLX_317 11.3% 93.7% 93.6% V5 0_1ins135;1694G>A n/a
Download CSV