Transcript: Human XM_017027330.2

PREDICTED: Homo sapiens PBX homeobox 4 (PBX4), transcript variant X8, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
PBX4 (80714)
Length:
628
CDS:
62..628

Additional Resources:

NCBI RefSeq record:
XM_017027330.2
NBCI Gene record:
PBX4 (80714)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017027330.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000017964 CGTGGCATTCAAGACGAAGAT pLKO.1 317 CDS 100% 4.950 6.930 N PBX4 n/a
2 TRCN0000017967 GCCAGAAAGCATGCTCTGAAT pLKO.1 176 CDS 100% 4.950 6.930 N PBX4 n/a
3 TRCN0000418830 AGCGTGCTCTGTGAGATCAAG pLKO_005 224 CDS 100% 4.950 3.465 N PBX4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017027330.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04216 pDONR223 100% 36.4% 31.6% None (many diffs) n/a
2 ccsbBroad304_04216 pLX_304 0% 36.4% 31.6% V5 (many diffs) n/a
3 TRCN0000475836 AATGCGTGCGCAGGACCCTAGGCA pLX_317 30.5% 36.4% 31.6% V5 (many diffs) n/a
Download CSV