Transcript: Human XM_017027418.1

PREDICTED: Homo sapiens TNF superfamily member 14 (TNFSF14), transcript variant X4, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
TNFSF14 (8740)
Length:
1506
CDS:
527..913

Additional Resources:

NCBI RefSeq record:
XM_017027418.1
NBCI Gene record:
TNFSF14 (8740)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017027418.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000436863 GACAGACCGACATCCCATTCA pLKO_005 570 CDS 100% 4.950 6.930 N TNFSF14 n/a
2 TRCN0000058739 GCGAAGGTCTCACGAGGTCAA pLKO.1 784 CDS 100% 1.350 1.890 N TNFSF14 n/a
3 TRCN0000417207 TCCTGGGAGCAGCTGATACAA pLKO_005 761 CDS 100% 5.625 3.938 N TNFSF14 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017027418.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11300 pDONR223 100% 64.7% 61.7% None (many diffs) n/a
2 ccsbBroad304_11300 pLX_304 0% 64.7% 61.7% V5 (many diffs) n/a
3 TRCN0000478814 ACTTCCCACGAAGTGAAATAATCT pLX_317 67.1% 64.7% 61.7% V5 (many diffs) n/a
4 TRCN0000491434 ACAATTTGACCGCTCTACCGATCA pLX_317 40.4% 48.1% 45.6% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV