Transcript: Human XM_017027614.1

PREDICTED: Homo sapiens cAMP-dependent protein kinase inhibitor gamma (PKIG), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
PKIG (11142)
Length:
1326
CDS:
423..653

Additional Resources:

NCBI RefSeq record:
XM_017027614.1
NBCI Gene record:
PKIG (11142)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017027614.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000296003 TGTAACCACAAGATGTTATTT pLKO_005 892 3UTR 100% 15.000 10.500 N PKIG n/a
2 TRCN0000296002 GAATCTGACCTTGTCCAAGAA pLKO_005 652 CDS 100% 4.950 3.465 N PKIG n/a
3 TRCN0000037965 CCTGACATCCAGGGAGACTCA pLKO.1 492 CDS 100% 0.880 0.616 N PKIG n/a
4 TRCN0000298852 CCTGACATCCAGGGAGACTCA pLKO_005 492 CDS 100% 0.880 0.616 N PKIG n/a
5 TRCN0000037968 ACTTCATCTCCTGTGACCGGA pLKO.1 451 CDS 100% 0.660 0.462 N PKIG n/a
6 TRCN0000037967 CGTGAGGAAGCTGGCTGGAGA pLKO.1 524 CDS 100% 0.000 0.000 N PKIG n/a
7 TRCN0000310346 CGTGAGGAAGCTGGCTGGAGA pLKO_005 524 CDS 100% 0.000 0.000 N PKIG n/a
8 TRCN0000037966 GCGATGGGACCACCTCGTCTT pLKO.1 631 CDS 100% 0.000 0.000 N PKIG n/a
9 TRCN0000298923 GCGATGGGACCACCTCGTCTT pLKO_005 631 CDS 100% 0.000 0.000 N PKIG n/a
10 TRCN0000037964 CCCAGACAAGGAAGCTGGCAA pLKO.1 596 CDS 100% 0.880 0.528 N PKIG n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017027614.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02626 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_02626 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000468977 GTTCGTCTCCGAGGATAGTAATGT pLX_317 100% 100% 100% V5 n/a
Download CSV