Transcript: Human XM_017027785.1

PREDICTED: Homo sapiens protein phosphatase 1 regulatory subunit 16B (PPP1R16B), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
PPP1R16B (26051)
Length:
5885
CDS:
694..1800

Additional Resources:

NCBI RefSeq record:
XM_017027785.1
NBCI Gene record:
PPP1R16B (26051)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017027785.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000257320 CGTTAGGTTCTGCGGATAAAG pLKO_005 4491 3UTR 100% 13.200 18.480 N PPP1R16B n/a
2 TRCN0000006920 CAGTGCTGCATCGACAACTTT pLKO.1 519 5UTR 100% 5.625 7.875 N PPP1R16B n/a
3 TRCN0000006917 CCAAGAGAATAAGGACCCTAA pLKO.1 1272 CDS 100% 4.050 5.670 N PPP1R16B n/a
4 TRCN0000231621 GCAATGGGACCTCGGTATATT pLKO_005 1685 CDS 100% 15.000 10.500 N PPP1R16B n/a
5 TRCN0000231620 CCCGTGCTACTCTCCGAATTT pLKO_005 1309 CDS 100% 13.200 9.240 N PPP1R16B n/a
6 TRCN0000231618 TCGACAACTTTGAGGAAATTG pLKO_005 529 5UTR 100% 13.200 9.240 N PPP1R16B n/a
7 TRCN0000006916 GCTGTATTTAACTCTTGCTAT pLKO.1 5543 3UTR 100% 4.950 3.465 N PPP1R16B n/a
8 TRCN0000103623 CCCTGATTTGTGCAATGAGGA pLKO.1 479 5UTR 100% 2.640 1.848 N Ppp1r16b n/a
9 TRCN0000006919 CCTCGGTATATTACACGGTCA pLKO.1 1694 CDS 100% 2.160 1.512 N PPP1R16B n/a
10 TRCN0000006918 GCTGAAGAAATGGGCACAGTA pLKO.1 299 5UTR 100% 4.950 2.970 N PPP1R16B n/a
11 TRCN0000103624 CCTGATTTGTGCAATGAGGAT pLKO.1 480 5UTR 100% 2.640 1.848 N Ppp1r16b n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017027785.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07980 pDONR223 100% 64.8% 64.9% None 0_1ins597;153C>T n/a
2 ccsbBroad304_07980 pLX_304 0% 64.8% 64.9% V5 0_1ins597;153C>T n/a
3 TRCN0000480319 ACCTTTCTTGTTACCCCCAAACTA pLX_317 20.6% 64.8% 64.9% V5 0_1ins597;153C>T n/a
Download CSV