Transcript: Human XM_017027868.2

PREDICTED: Homo sapiens PHD finger protein 20 (PHF20), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
PHF20 (51230)
Length:
5719
CDS:
101..2974

Additional Resources:

NCBI RefSeq record:
XM_017027868.2
NBCI Gene record:
PHF20 (51230)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017027868.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000016313 CCCGAGAAATACACCTGTTAT pLKO.1 2000 CDS 100% 13.200 18.480 N PHF20 n/a
2 TRCN0000379949 AGCGTTGGAACCATCGTTATG pLKO_005 243 CDS 100% 10.800 15.120 N PHF20 n/a
3 TRCN0000225873 GTGGGTAATGCTAGGCCTAAA pLKO_005 362 CDS 100% 10.800 15.120 N Phf20 n/a
4 TRCN0000382197 GTGGGTAATGCTAGGCCTAAA pLKO_005 362 CDS 100% 10.800 15.120 N PHF20 n/a
5 TRCN0000379882 AGCATTGGAGGAGGATAATTT pLKO_005 1753 CDS 100% 15.000 10.500 N PHF20 n/a
6 TRCN0000016314 CCTGATAAAGAAGGAAAGTTA pLKO.1 515 CDS 100% 5.625 3.938 N PHF20 n/a
7 TRCN0000016316 GCATGGGATTACTGGAAGAAA pLKO.1 1974 CDS 100% 5.625 3.938 N PHF20 n/a
8 TRCN0000016315 CCAGCTCACATAGAAGACATT pLKO.1 188 CDS 100% 4.950 3.465 N PHF20 n/a
9 TRCN0000016317 CCTGACTTGGTTGTATCAGAT pLKO.1 959 CDS 100% 4.950 3.465 N PHF20 n/a
10 TRCN0000380621 ATTGTGCCACTGATGATAAAC pLKO_005 3261 3UTR 100% 13.200 7.920 N PHF20 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017027868.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08258 pDONR223 100% 94.5% 94.4% None 255_256ins165;1648G>A n/a
2 ccsbBroad304_08258 pLX_304 0% 94.5% 94.4% V5 255_256ins165;1648G>A n/a
3 TRCN0000481434 CCCTCCTTGTTAAAGCGGCATCAG pLX_317 14.2% 94.5% 94.4% V5 255_256ins165;1648G>A n/a
Download CSV