Transcript: Human XM_017027875.1

PREDICTED: Homo sapiens tRNA methyltransferase 6 (TRMT6), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
TRMT6 (51605)
Length:
2446
CDS:
796..1743

Additional Resources:

NCBI RefSeq record:
XM_017027875.1
NBCI Gene record:
TRMT6 (51605)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017027875.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000425454 AGGCATTATACAGTTAGTAAT pLKO_005 1776 3UTR 100% 13.200 18.480 N TRMT6 n/a
2 TRCN0000139336 CGATACACTAGCCCAGATGTT pLKO.1 804 CDS 100% 4.950 6.930 N TRMT6 n/a
3 TRCN0000141588 CCACATGAGATACGATACACT pLKO.1 792 5UTR 100% 3.000 4.200 N TRMT6 n/a
4 TRCN0000142390 GCACTTTAGAATCACACGAGA pLKO.1 1673 CDS 100% 2.640 3.696 N TRMT6 n/a
5 TRCN0000417925 GAAACGCAGATGGTTTAATTG pLKO_005 1349 CDS 100% 13.200 10.560 N TRMT6 n/a
6 TRCN0000413742 TTCTTTCCTGCAGCGGAATAA pLKO_005 2218 3UTR 100% 13.200 9.240 N TRMT6 n/a
7 TRCN0000141871 GCTGAAACGTGAAGATGTGTT pLKO.1 209 5UTR 100% 4.950 3.465 N TRMT6 n/a
8 TRCN0000143339 GATGTTATCTTCAGAGCCAAA pLKO.1 1068 CDS 100% 4.050 2.835 N TRMT6 n/a
9 TRCN0000140733 GTCTGAAACCTGGCTCAGAAA pLKO.1 1524 CDS 100% 0.495 0.347 N TRMT6 n/a
10 TRCN0000141253 CCTAAAGAGAGAGGAAGCAAA pLKO.1 1246 CDS 100% 4.950 2.970 N TRMT6 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017027875.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03342 pDONR223 100% 63.3% 63.3% None 0_1ins546 n/a
2 ccsbBroad304_03342 pLX_304 0% 63.3% 63.3% V5 0_1ins546 n/a
3 TRCN0000465684 CTGAATCTTTTTCCTGAGTGGAGG pLX_317 27.5% 63.3% 63.3% V5 0_1ins546 n/a
Download CSV