Transcript: Human XM_017027956.1

PREDICTED: Homo sapiens NSFL1 cofactor (NSFL1C), transcript variant X4, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
NSFL1C (55968)
Length:
4111
CDS:
1566..2528

Additional Resources:

NCBI RefSeq record:
XM_017027956.1
NBCI Gene record:
NSFL1C (55968)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017027956.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000377534 ATCGTGCAGCGGTTAACATAA pLKO_005 2508 CDS 100% 13.200 18.480 N NSFL1C n/a
2 TRCN0000160212 CCCTATAAGTTTGATTGCTAT pLKO.1 3659 3UTR 100% 4.950 6.930 N NSFL1C n/a
3 TRCN0000322808 CCACTTGTTCCCACGAGAATA pLKO_005 2991 3UTR 100% 13.200 9.240 N NSFL1C n/a
4 TRCN0000160949 GCTGGTGGATGATCTCTTTAA pLKO.1 1766 CDS 100% 13.200 9.240 N NSFL1C n/a
5 TRCN0000163558 GAGTGGATTCAGCCTGGATAA pLKO.1 1979 CDS 100% 10.800 7.560 N NSFL1C n/a
6 TRCN0000322807 GAGTGGATTCAGCCTGGATAA pLKO_005 1979 CDS 100% 10.800 7.560 N NSFL1C n/a
7 TRCN0000030465 AGCTACCAAGACCCATCCAAT pLKO.1 2013 CDS 100% 4.950 3.465 N Nsfl1c n/a
8 TRCN0000279306 AGCTACCAAGACCCATCCAAT pLKO_005 2013 CDS 100% 4.950 3.465 N Nsfl1c n/a
9 TRCN0000030468 CCAGAGGAAGAGTCTGCCTAT pLKO.1 1896 CDS 100% 4.050 2.835 N Nsfl1c n/a
10 TRCN0000297657 CCAGAGGAAGAGTCTGCCTAT pLKO_005 1896 CDS 100% 4.050 2.835 N Nsfl1c n/a
11 TRCN0000164655 GAGGACTTTGTGAAGCCCAAA pLKO.1 2136 CDS 100% 4.050 2.430 N NSFL1C n/a
12 TRCN0000350655 GAGGACTTTGTGAAGCCCAAA pLKO_005 2136 CDS 100% 4.050 2.430 N NSFL1C n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017027956.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03687 pDONR223 100% 84.4% 82.7% None (many diffs) n/a
2 ccsbBroad304_03687 pLX_304 0% 84.4% 82.7% V5 (many diffs) n/a
3 TRCN0000480798 GCCCGCGGTGGGCAGTGATTACAG pLX_317 39.2% 84.4% 82.7% V5 (many diffs) n/a
Download CSV