Transcript: Human XM_017028311.1

PREDICTED: Homo sapiens MORC family CW-type zinc finger 3 (MORC3), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
MORC3 (23515)
Length:
4259
CDS:
312..2918

Additional Resources:

NCBI RefSeq record:
XM_017028311.1
NBCI Gene record:
MORC3 (23515)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017028311.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000272715 ACTATTCCCTGAGGGCTTATT pLKO_005 841 CDS 100% 13.200 18.480 N MORC3 n/a
2 TRCN0000001336 CCCGAGGATTTAGATGAGATA pLKO.1 762 CDS 100% 4.950 6.930 N MORC3 n/a
3 TRCN0000001335 GCTTAATACGTGTCGGTCATA pLKO.1 4053 3UTR 100% 4.950 6.930 N MORC3 n/a
4 TRCN0000281946 GCTTAATACGTGTCGGTCATA pLKO_005 4053 3UTR 100% 4.950 6.930 N MORC3 n/a
5 TRCN0000001337 GCCAATTACAAGAACTGAGAA pLKO.1 2179 CDS 100% 4.950 3.960 N MORC3 n/a
6 TRCN0000272664 ATTGAGAGGGACCAGTATAAA pLKO_005 2580 CDS 100% 15.000 10.500 N MORC3 n/a
7 TRCN0000272661 CAGTGATAAATGACCATATAT pLKO_005 262 5UTR 100% 15.000 10.500 N MORC3 n/a
8 TRCN0000272716 ACTCCGATCTCTTCGAGTTAA pLKO_005 2771 CDS 100% 13.200 9.240 N MORC3 n/a
9 TRCN0000001338 CCTGTCTAAAGTGGCGGAAAT pLKO.1 1342 CDS 100% 10.800 7.560 N MORC3 n/a
10 TRCN0000001339 GTGAGGTTGAATTGCTGGAAA pLKO.1 2602 CDS 100% 4.950 3.465 N MORC3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017028311.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07893 pDONR223 100% 92.3% 92.3% None (many diffs) n/a
2 ccsbBroad304_07893 pLX_304 0% 92.3% 92.3% V5 (many diffs) n/a
3 TRCN0000481550 AGATGATATCTCGAATGAATTAGG pLX_317 17.5% 92.3% 92.3% V5 (many diffs) n/a
Download CSV