Transcript: Human XM_017028424.2

PREDICTED: Homo sapiens S100 calcium binding protein B (S100B), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
S100B (6285)
Length:
925
CDS:
240..518

Additional Resources:

NCBI RefSeq record:
XM_017028424.2
NBCI Gene record:
S100B (6285)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017028424.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000419211 AGTCAGGTCTCAGTGATAAAG pLKO_005 775 3UTR 100% 13.200 18.480 N S100B n/a
2 TRCN0000423145 CATCATTCTTTCTGCTATATT pLKO_005 700 3UTR 100% 15.000 10.500 N S100B n/a
3 TRCN0000053994 GCCTGCCACGAGTTCTTTGAA pLKO.1 489 CDS 100% 5.625 3.938 N S100B n/a
4 TRCN0000418930 CCGAACTGAAGGAGCTCATCA pLKO_005 331 CDS 100% 4.950 3.465 N S100B n/a
5 TRCN0000053997 TGGAGACGGCGAATGTGACTT pLKO.1 431 CDS 100% 4.950 3.465 N S100B n/a
6 TRCN0000053996 ACACTGGACAATGATGGAGAC pLKO.1 417 CDS 100% 2.250 1.575 N S100B n/a
7 TRCN0000053995 GACAATGATGGAGACGGCGAA pLKO.1 423 CDS 100% 2.160 1.512 N S100B n/a
8 TRCN0000417915 AGCAGGAGGTTGTGGACAAAG pLKO_005 388 CDS 100% 10.800 6.480 N S100B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017028424.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06908 pDONR223 100% 99.6% 100% None 99G>C n/a
2 ccsbBroad304_06908 pLX_304 0% 99.6% 100% V5 99G>C n/a
3 TRCN0000474683 ATAGTACAAGTCGTTACCACGCCC pLX_317 100% 99.6% 100% V5 99G>C n/a
Download CSV