Transcript: Human XM_017028538.2

PREDICTED: Homo sapiens nucleoporin 50 (NUP50), transcript variant X8, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
NUP50 (10762)
Length:
4897
CDS:
885..1541

Additional Resources:

NCBI RefSeq record:
XM_017028538.2
NBCI Gene record:
NUP50 (10762)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017028538.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000220055 ACTGCAATCAGGGTATCAATT pLKO.1 1830 3UTR 100% 13.200 18.480 N NUP50 n/a
2 TRCN0000159335 GAAGAATAGAGCCATAAAGAA pLKO.1 426 5UTR 100% 5.625 7.875 N NUP50 n/a
3 TRCN0000220054 GTGATCTGACACCTATCTTTA pLKO.1 676 5UTR 100% 13.200 10.560 N NUP50 n/a
4 TRCN0000332978 GTGATCTGACACCTATCTTTA pLKO_005 676 5UTR 100% 13.200 10.560 N NUP50 n/a
5 TRCN0000158766 GCATAGGTACTCTGCATTTAA pLKO.1 1264 CDS 100% 15.000 10.500 N NUP50 n/a
6 TRCN0000344518 GCATAGGTACTCTGCATTTAA pLKO_005 1264 CDS 100% 15.000 10.500 N NUP50 n/a
7 TRCN0000220053 GGATAGTGAAGCACGTGAATA pLKO.1 643 5UTR 100% 13.200 9.240 N NUP50 n/a
8 TRCN0000363723 GGATAGTGAAGCACGTGAATA pLKO_005 643 5UTR 100% 13.200 9.240 N NUP50 n/a
9 TRCN0000158499 CGCAGAAATGTTGGATTTGAA pLKO.1 454 5UTR 100% 5.625 3.938 N NUP50 n/a
10 TRCN0000160160 CAAAGATACTACCCAGAGTAA pLKO.1 1046 CDS 100% 4.950 3.465 N NUP50 n/a
11 TRCN0000160526 CCTCATTTAATTTCGGCAAGA pLKO.1 940 CDS 100% 4.050 2.835 N NUP50 n/a
12 TRCN0000161887 GCTGCAGAATTATTGCCAAGT pLKO.1 1555 3UTR 100% 4.050 2.835 N NUP50 n/a
13 TRCN0000162422 CCCAAAGTAGTAGTTACCGAA pLKO.1 1167 CDS 100% 2.640 1.848 N NUP50 n/a
14 TRCN0000344581 CCCAAAGTAGTAGTTACCGAA pLKO_005 1167 CDS 100% 2.640 1.848 N NUP50 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017028538.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07675 pDONR223 100% 49.4% 49.5% None 0_1ins666;318T>C n/a
2 ccsbBroad304_07675 pLX_304 0% 49.4% 49.5% V5 0_1ins666;318T>C n/a
3 TRCN0000469059 AAGGTAAAACCAGTCTTACAGACA pLX_317 27.2% 49.4% 49.5% V5 0_1ins666;318T>C n/a
Download CSV