Transcript: Human XM_017028799.2

PREDICTED: Homo sapiens SRR1 domain containing (SRRD), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
SRRD (402055)
Length:
1132
CDS:
2..682

Additional Resources:

NCBI RefSeq record:
XM_017028799.2
NBCI Gene record:
SRRD (402055)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017028799.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000142845 CTATGGAGGAACTACAGAGAA pLKO.1 933 3UTR 100% 4.950 6.930 N SRRD n/a
2 TRCN0000143183 GCTAGAAACCAGCTAACGTTT pLKO.1 464 CDS 100% 4.950 6.930 N SRRD n/a
3 TRCN0000145268 GAACAGCTCTCCATAGATATT pLKO.1 756 3UTR 100% 13.200 9.240 N SRRD n/a
4 TRCN0000143076 CAGAAGTCACTGTTGGGTATA pLKO.1 517 CDS 100% 10.800 7.560 N SRRD n/a
5 TRCN0000145174 GCACTAGAAACCATCAATAGA pLKO.1 245 CDS 100% 5.625 3.938 N SRRD n/a
6 TRCN0000141236 CCCTCTGTTTAGCCAACTTGA pLKO.1 541 CDS 100% 4.950 3.465 N SRRD n/a
7 TRCN0000143598 GCCAGGAAAGAACATCAACTT pLKO.1 961 3UTR 100% 4.950 3.465 N SRRD n/a
8 TRCN0000141613 CATCAACTTGGCTGTCCTGTT pLKO.1 973 3UTR 100% 4.050 2.835 N SRRD n/a
9 TRCN0000122654 GAGAACTCCTTTGCCAGGAAA pLKO.1 949 3UTR 100% 4.950 2.970 N SRRD n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017028799.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14501 pDONR223 100% 64.3% 58.3% None (many diffs) n/a
2 ccsbBroad304_14501 pLX_304 0% 64.3% 58.3% V5 (not translated due to frame shift) (many diffs) n/a
3 TRCN0000475917 TGCCGGAGTCATCAAACTTAGTCC pLX_317 27.6% 64.3% 58.3% V5 (not translated due to frame shift) (many diffs) n/a
Download CSV