Transcript: Human XM_017028810.1

PREDICTED: Homo sapiens neurofibromin 2 (NF2), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
NF2 (4771)
Length:
5631
CDS:
117..1775

Additional Resources:

NCBI RefSeq record:
XM_017028810.1
NBCI Gene record:
NF2 (4771)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017028810.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000237847 TCGGGAACCATGATCTATTTA pLKO_005 904 CDS 100% 15.000 21.000 N NF2 n/a
2 TRCN0000039977 CGACTTCAAAGATACTGACAT pLKO.1 1523 CDS 100% 4.950 6.930 N NF2 n/a
3 TRCN0000010398 CATACCAAGCTTCAACCTCAT pLKO.1 1484 CDS 100% 4.050 5.670 N NF2 n/a
4 TRCN0000018338 TAGTTCTCTGACCTGAGTCTT pLKO.1 2044 3UTR 100% 4.950 3.960 N NF2 n/a
5 TRCN0000244295 AGCAAGCACAATACCATTAAA pLKO_005 1716 CDS 100% 15.000 10.500 N NF2 n/a
6 TRCN0000237846 CTGTGTTGTCCACCCTATTAT pLKO_005 5185 3UTR 100% 15.000 10.500 N NF2 n/a
7 TRCN0000237845 GACAAGGAGTTTACTATTAAA pLKO_005 804 CDS 100% 15.000 10.500 N NF2 n/a
8 TRCN0000237848 TACTTTGCAATCCGGAATAAA pLKO_005 663 CDS 100% 15.000 10.500 N NF2 n/a
9 TRCN0000039973 CGGGCTTTGTTTCCTTCTTTA pLKO.1 4272 3UTR 100% 13.200 9.240 N NF2 n/a
10 TRCN0000039974 GCTCTGGATATTCTGCACAAT pLKO.1 1671 CDS 100% 4.950 3.465 N NF2 n/a
11 TRCN0000039976 CCCGTGGAATGAAATCCGAAA pLKO.1 770 CDS 100% 4.050 2.835 N NF2 n/a
12 TRCN0000039975 GCTTCGTGTTAATAAGCTGAT pLKO.1 869 CDS 100% 4.050 2.835 N NF2 n/a
13 TRCN0000430981 GCCACCATGCCTGGCTAATTT pLKO_005 3999 3UTR 100% 15.000 7.500 Y GTF2IRD2 n/a
14 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 4856 3UTR 100% 5.625 2.813 Y KLHL30 n/a
15 TRCN0000264189 CAAGTAGCTGGGACTACAGGA pLKO_005 3231 3UTR 100% 2.640 1.320 Y LINC01098 n/a
16 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 4856 3UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017028810.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01087 pDONR223 100% 88.6% 86.4% None (many diffs) n/a
2 ccsbBroad304_01087 pLX_304 0% 88.6% 86.4% V5 (many diffs) n/a
3 TRCN0000468924 AAGGCCGCCAGGCTCCATGAATCA pLX_317 27.6% 88.6% 86.4% V5 (many diffs) n/a
Download CSV