Transcript: Human XM_017028813.1

PREDICTED: Homo sapiens aspartate rich 1 (DRICH1), transcript variant X6, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
DRICH1 (51233)
Length:
997
CDS:
299..958

Additional Resources:

NCBI RefSeq record:
XM_017028813.1
NBCI Gene record:
DRICH1 (51233)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017028813.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000163557 GCACCCTGTTATGAATCTGAT pLKO.1 359 CDS 100% 4.950 3.960 N DRICH1 n/a
2 TRCN0000165295 GTATGCCTACCACGAAGTGAA pLKO.1 623 CDS 100% 4.950 3.960 N DRICH1 n/a
3 TRCN0000163366 GAGGACAACCTGAGTTTAGTA pLKO.1 605 CDS 100% 5.625 3.938 N DRICH1 n/a
4 TRCN0000164188 CGGTTTGATAGCAGTTCTTGT pLKO.1 716 CDS 100% 4.950 3.465 N DRICH1 n/a
5 TRCN0000163283 GCAACATCAGAATCCACTACT pLKO.1 407 CDS 100% 4.950 3.465 N DRICH1 n/a
6 TRCN0000166183 CGCACCCTGTTATGAATCTGA pLKO.1 358 CDS 100% 3.000 2.100 N DRICH1 n/a
7 TRCN0000164301 CCATCAAGTGAGGAAGACAAT pLKO.1 542 CDS 100% 4.950 2.970 N DRICH1 n/a
8 TRCN0000166730 CCTACCACGAAGTGAAGATGA pLKO.1 628 CDS 100% 4.950 2.970 N DRICH1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017028813.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03250 pDONR223 100% 92.7% 91.3% None (many diffs) n/a
2 ccsbBroad304_03250 pLX_304 0% 92.7% 91.3% V5 (many diffs) n/a
3 TRCN0000474111 TGTGACAGGAGAAAAACGGCGGTC pLX_317 66.6% 92.7% 91.3% V5 (many diffs) n/a
4 ccsbBroadEn_15833 pDONR223 0% 47.6% 32.2% None (many diffs) n/a
5 ccsbBroad304_15833 pLX_304 0% 47.6% 32.2% V5 (many diffs) n/a
Download CSV