Transcript: Human XM_017028936.1

PREDICTED: Homo sapiens ALG12 alpha-1,6-mannosyltransferase (ALG12), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ALG12 (79087)
Length:
1652
CDS:
286..1629

Additional Resources:

NCBI RefSeq record:
XM_017028936.1
NBCI Gene record:
ALG12 (79087)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017028936.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000035479 CGGTTGCTGTGGACTCTTATT pLKO.1 956 CDS 100% 13.200 10.560 N ALG12 n/a
2 TRCN0000035481 CCTGTATGTGTCCCATTTCAA pLKO.1 1371 CDS 100% 5.625 3.938 N ALG12 n/a
3 TRCN0000422222 TGGGCTTCATGGCACTCTACT pLKO_005 1172 CDS 100% 4.950 3.465 N ALG12 n/a
4 TRCN0000035483 GCTAATAGTTAGAGGAGTGCT pLKO.1 573 CDS 100% 2.640 1.848 N ALG12 n/a
5 TRCN0000035482 CCCGCTGCTGTGGTACTTCTA pLKO.1 1059 CDS 100% 1.650 1.155 N ALG12 n/a
6 TRCN0000035480 CTGTTAGAAATGTCCAAGTTT pLKO.1 544 CDS 100% 5.625 3.375 N ALG12 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017028936.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04045 pDONR223 100% 88.2% 86.4% None (many diffs) n/a
2 ccsbBroad304_04045 pLX_304 0% 88.2% 86.4% V5 (many diffs) n/a
3 TRCN0000465521 TTTTACGTACGTCTACTGTTGTTT pLX_317 27% 88.2% 86.4% V5 (many diffs) n/a
Download CSV