Transcript: Human XM_017029167.2

PREDICTED: Homo sapiens putative POM121-like protein 1 (LOC101929738), mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
LOC101929738 (101929738)
Length:
2379
CDS:
459..1847

Additional Resources:

NCBI RefSeq record:
XM_017029167.2
NBCI Gene record:
LOC101929738 (101929738)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017029167.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000162242 CAGAGGTCAGAAATCAGATAT pLKO.1 750 CDS 100% 13.200 6.600 Y POM121L9P n/a
2 TRCN0000163328 CCAGAGGTCAGAAATCAGATA pLKO.1 749 CDS 100% 4.950 2.475 Y POM121L9P n/a
3 TRCN0000166031 CCCAGAGGTCAGAAATCAGAT pLKO.1 748 CDS 100% 4.950 2.475 Y POM121L9P n/a
4 TRCN0000165033 GTCCAAGAGAATCCTGGTGAT pLKO.1 609 CDS 100% 4.050 2.025 Y POM121L9P n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017029167.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10587 pDONR223 100% 90.1% 87.6% None (many diffs) n/a
2 ccsbBroad304_10587 pLX_304 0% 90.1% 87.6% V5 (many diffs) n/a
3 TRCN0000472538 GCTGGAAACCAGACTTGAAGCAAA pLX_317 39.6% 90.1% 87.6% V5 (many diffs) n/a
Download CSV