Transcript: Human XM_017029223.2

PREDICTED: Homo sapiens solute carrier family 9 member A6 (SLC9A6), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
SLC9A6 (10479)
Length:
4601
CDS:
245..2194

Additional Resources:

NCBI RefSeq record:
XM_017029223.2
NBCI Gene record:
SLC9A6 (10479)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017029223.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000370908 ACCGGCCTGGCTATGATTTAT pLKO_005 392 CDS 100% 15.000 21.000 N SLC9A6 n/a
2 TRCN0000304188 TTACTTCCTCCTATCATATTT pLKO_005 647 CDS 100% 15.000 21.000 N SLC9A6 n/a
3 TRCN0000043766 GTTTCGTTATTGGGTCAATAA pLKO.1 756 CDS 100% 1.320 1.848 N SLC9A6 n/a
4 TRCN0000043764 CCCTCTTACTTAATTTGGGTA pLKO.1 1482 CDS 100% 2.640 2.112 N SLC9A6 n/a
5 TRCN0000304189 CTGAATGTGTAAGCTATATAA pLKO_005 2283 3UTR 100% 15.000 10.500 N SLC9A6 n/a
6 TRCN0000043763 CCCGCTAAATTTGTTAGATAA pLKO.1 2152 CDS 100% 13.200 9.240 N SLC9A6 n/a
7 TRCN0000370966 GTCCAGCCTAAGCTTACTAAT pLKO_005 2184 CDS 100% 13.200 9.240 N SLC9A6 n/a
8 TRCN0000304128 CAGCGATGTTCAAGTCTATTG pLKO_005 1041 CDS 100% 10.800 7.560 N SLC9A6 n/a
9 TRCN0000043765 GCATAGAACTAAACAGTTGTT pLKO.1 1309 CDS 100% 4.950 3.465 N SLC9A6 n/a
10 TRCN0000300867 GCATAGAACTAAACAGTTGTT pLKO_005 1309 CDS 100% 4.950 3.465 N SLC9A6 n/a
11 TRCN0000043767 CCCAAGGAGATTTATGGGAAA pLKO.1 2032 CDS 100% 4.050 2.835 N SLC9A6 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017029223.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07618 pDONR223 100% 92.5% 92.5% None 0_1ins156;1053C>A n/a
2 ccsbBroad304_07618 pLX_304 0% 92.5% 92.5% V5 0_1ins156;1053C>A n/a
3 TRCN0000478526 AAGAGACCTCTCTCATGGTACATT pLX_317 15.4% 92.5% 92.5% V5 0_1ins156;1053C>A n/a
Download CSV