Transcript: Human XM_017029254.2

PREDICTED: Homo sapiens dachshund family transcription factor 2 (DACH2), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
DACH2 (117154)
Length:
2408
CDS:
171..1961

Additional Resources:

NCBI RefSeq record:
XM_017029254.2
NBCI Gene record:
DACH2 (117154)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017029254.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000415375 AGACTCTGTTGACCAACATTC pLKO_005 1498 CDS 100% 10.800 15.120 N DACH2 n/a
2 TRCN0000020813 AGGAGGTAACTATTACTGTTT pLKO.1 1910 CDS 100% 4.950 6.930 N DACH2 n/a
3 TRCN0000417908 CATTAGACTGACCAGTTTAAA pLKO_005 2154 3UTR 100% 15.000 10.500 N DACH2 n/a
4 TRCN0000020809 CCCTCGTCTTACTCCTAATAT pLKO.1 275 CDS 100% 15.000 10.500 N DACH2 n/a
5 TRCN0000020810 CCCTCTCAGATGGATCATCAT pLKO.1 1338 CDS 100% 4.950 3.465 N DACH2 n/a
6 TRCN0000020811 CCATTTATGATGATGCCTCAT pLKO.1 1074 CDS 100% 4.050 2.835 N DACH2 n/a
7 TRCN0000020812 CGTGGTTAATAACCACAGCAA pLKO.1 308 CDS 100% 0.264 0.185 N DACH2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017029254.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13061 pDONR223 100% 75.1% 72.7% None (many diffs) n/a
2 ccsbBroad304_13061 pLX_304 0% 75.1% 72.7% V5 (many diffs) n/a
3 TRCN0000473331 TGCTGATAAACTCCCGCTAAAGCA pLX_317 35.9% 75.1% 72.7% V5 (many diffs) n/a
Download CSV