Transcript: Human XM_017029297.1

PREDICTED: Homo sapiens zinc finger DHHC-type containing 15 (ZDHHC15), transcript variant X7, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ZDHHC15 (158866)
Length:
3400
CDS:
348..914

Additional Resources:

NCBI RefSeq record:
XM_017029297.1
NBCI Gene record:
ZDHHC15 (158866)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017029297.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000414704 TGGGTGCCAGTGCTCGTTATT pLKO_005 85 5UTR 100% 13.200 18.480 N Zdhhc15 n/a
2 TRCN0000142769 CTACGACAGTCTTCAGCTATT pLKO.1 466 CDS 100% 10.800 15.120 N ZDHHC15 n/a
3 TRCN0000440349 TCGTGCTCTGGTCCTACTATG pLKO_005 113 5UTR 100% 10.800 15.120 N ZDHHC15 n/a
4 TRCN0000144008 CCTTGGGTTAATAACTGCATT pLKO.1 378 CDS 100% 4.950 6.930 N ZDHHC15 n/a
5 TRCN0000145236 GTGATTCTCTTTGGTTACCAT pLKO.1 582 CDS 100% 3.000 4.200 N ZDHHC15 n/a
6 TRCN0000415498 ACGACAGTCTTCAGCTATTTC pLKO_005 468 CDS 100% 13.200 10.560 N ZDHHC15 n/a
7 TRCN0000141124 CCAGCAGGTGTTTGGAGATAA pLKO.1 710 CDS 100% 13.200 9.240 N ZDHHC15 n/a
8 TRCN0000122426 GCAAATGAAGAAACCTGGGAA pLKO.1 825 CDS 100% 2.640 1.848 N ZDHHC15 n/a
9 TRCN0000008902 CCTCCCAAAGTGTTGGGATTA pLKO.1 2806 3UTR 100% 1.080 0.540 Y GPR83 n/a
10 TRCN0000156315 CCTCCCAAAGTGTTGGGATTA pLKO.1 2806 3UTR 100% 1.080 0.540 Y MYORG n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017029297.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05099 pDONR223 100% 55.7% 55.7% None 0_1ins447 n/a
2 ccsbBroad304_05099 pLX_304 0% 55.7% 55.7% V5 0_1ins447 n/a
3 TRCN0000478971 ATGGGTTCTGTAGGGCCGCCGCAA pLX_317 36.5% 55.7% 55.7% V5 0_1ins447 n/a
Download CSV