Transcript: Human XM_017029337.1

PREDICTED: Homo sapiens ectodysplasin A (EDA), transcript variant X4, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
EDA (1896)
Length:
5471
CDS:
224..625

Additional Resources:

NCBI RefSeq record:
XM_017029337.1
NBCI Gene record:
EDA (1896)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017029337.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000058806 CTGCTCTTCCTGGGTTTCTTT pLKO.1 344 CDS 100% 5.625 3.938 N EDA n/a
2 TRCN0000172742 GAGACAGAGTCTTGCTCTGTT pLKO.1 5293 3UTR 100% 0.495 0.248 Y C11orf44 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017029337.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00475 pDONR223 100% 34% 33.7% None 397_398insTG;399_400ins772 n/a
2 ccsbBroad304_00475 pLX_304 0% 34% 33.7% V5 397_398insTG;399_400ins772 n/a
3 TRCN0000469272 GGAGTCGTGAAACAACACGTTTGC pLX_317 32.6% 34% 33.7% V5 397_398insTG;399_400ins772 n/a
Download CSV