Transcript: Human XM_017029356.1

PREDICTED: Homo sapiens FA complementation group B (FANCB), transcript variant X6, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
FANCB (2187)
Length:
4538
CDS:
462..2960

Additional Resources:

NCBI RefSeq record:
XM_017029356.1
NBCI Gene record:
FANCB (2187)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017029356.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000159760 GTTGTTTATCTGAGGAAGAAT pLKO.1 1027 CDS 100% 5.625 3.938 N FANCB n/a
2 TRCN0000160545 CCAGTTAAGAATATCTCTCAT pLKO.1 1211 CDS 100% 4.950 3.465 N FANCB n/a
3 TRCN0000163896 CGGCTGCTTTATCAGACAGAA pLKO.1 2857 CDS 100% 4.950 3.465 N FANCB n/a
4 TRCN0000160916 GCTGTATGGAAAGAGAGCTTT pLKO.1 1389 CDS 100% 4.950 3.465 N FANCB n/a
5 TRCN0000163131 GCACTTCTTGCAGCATTCCAT pLKO.1 2409 CDS 100% 3.000 2.100 N FANCB n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017029356.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00538 pDONR223 100% 96.5% 96.5% None (many diffs) n/a
2 ccsbBroad304_00538 pLX_304 0% 96.5% 96.5% V5 (many diffs) n/a
3 TRCN0000477623 ATGGTGGAAGCTGAAGGTCACACT pLX_317 17.2% 96.5% 96.5% V5 (many diffs) n/a
Download CSV