Transcript: Human XM_017029452.1

PREDICTED: Homo sapiens cilia and flagella associated protein 47 (CFAP47), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
CFAP47 (286464)
Length:
8114
CDS:
60..8033

Additional Resources:

NCBI RefSeq record:
XM_017029452.1
NBCI Gene record:
CFAP47 (286464)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017029452.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000167221 CGGCTACTTATTTCAATAGAA pLKO.1 411 CDS 100% 5.625 7.875 N CFAP47 n/a
2 TRCN0000145526 GAGACTATAAGAAGGGATGTA pLKO.1 4737 CDS 100% 4.950 6.930 N CFAP47 n/a
3 TRCN0000168831 CGCAAGAATTATGCACCTGTA pLKO.1 1719 CDS 100% 4.050 5.670 N CFAP47 n/a
4 TRCN0000141263 CCAGAGACTATAAGAAGGGAT pLKO.1 4734 CDS 100% 2.640 2.112 N CFAP47 n/a
5 TRCN0000140066 CAACACAGTTGGGAGCCTATT pLKO.1 5446 CDS 100% 10.800 7.560 N CFAP47 n/a
6 TRCN0000168634 GCCAGTGAAGGATATGCTATT pLKO.1 1793 CDS 100% 10.800 7.560 N CFAP47 n/a
7 TRCN0000142319 GAACCTGCAAAGGGAAACTTA pLKO.1 4497 CDS 100% 5.625 3.938 N CFAP47 n/a
8 TRCN0000167652 GAGATGCTCTTGAGTATCAAA pLKO.1 738 CDS 100% 5.625 3.938 N CFAP47 n/a
9 TRCN0000144022 CCATTCTTGATTGAGTCTCAT pLKO.1 5469 CDS 100% 4.950 3.465 N CFAP47 n/a
10 TRCN0000143034 CCTGAAGAGTATCTGCACAAT pLKO.1 5520 CDS 100% 4.950 3.465 N CFAP47 n/a
11 TRCN0000142490 GACCTTTCAGATGGTCTTGTT pLKO.1 5421 CDS 100% 4.950 3.465 N CFAP47 n/a
12 TRCN0000144839 GAAATTGACTTTGACGTGGAA pLKO.1 5568 CDS 100% 2.640 1.848 N CFAP47 n/a
13 TRCN0000140895 GAAGATCATGGGTCTCTGGAA pLKO.1 4578 CDS 100% 2.640 1.848 N CFAP47 n/a
14 TRCN0000168579 GCAGCTTAATGTTGACACCAA pLKO.1 2269 CDS 100% 2.640 1.584 N CFAP47 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017029452.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14424 pDONR223 100% 28.2% 28.1% None (many diffs) n/a
2 ccsbBroad304_14424 pLX_304 0% 28.2% 28.1% V5 (many diffs) n/a
3 TRCN0000471143 TTCTTACTATCCCATGCCCGGGTT pLX_317 20.4% 28.2% 28.1% V5 (many diffs) n/a
4 ccsbBroadEn_05415 pDONR223 100% 17.7% 16% None (many diffs) n/a
5 ccsbBroad304_05415 pLX_304 0% 17.7% 16% V5 (many diffs) n/a
6 TRCN0000476305 AGCAGAGGGTAGTGAACCTATGTC pLX_317 14.1% 17.7% 16% V5 (many diffs) n/a
Download CSV