Transcript: Human XM_017029517.1

PREDICTED: Homo sapiens XK related X-linked (XKRX), transcript variant X4, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
XKRX (402415)
Length:
1942
CDS:
312..1049

Additional Resources:

NCBI RefSeq record:
XM_017029517.1
NBCI Gene record:
XKRX (402415)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017029517.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000455043 ATCACCATCTGGCGGACATTG pLKO_005 426 CDS 100% 10.800 15.120 N XKRX n/a
2 TRCN0000157405 GACAGAGATCTCGTCGACAAA pLKO.1 705 CDS 100% 4.950 6.930 N XKRX n/a
3 TRCN0000153422 GCTATCCAGATCAAGTACGAT pLKO.1 366 CDS 100% 3.000 4.200 N XKRX n/a
4 TRCN0000158266 CCCAGGAAACAGTCTGACTAA pLKO.1 1479 3UTR 100% 4.950 3.465 N XKRX n/a
5 TRCN0000158208 CCTCTCACTTAGTGCCTCATT pLKO.1 1792 3UTR 100% 4.950 2.970 N XKRX n/a
6 TRCN0000152682 GCTCTCTAAAGTGACCTTCTA pLKO.1 1337 3UTR 100% 4.950 2.970 N XKRX n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017029517.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10137 pDONR223 100% 53% 53% None 0_1ins651 n/a
2 ccsbBroad304_10137 pLX_304 0% 53% 53% V5 0_1ins651 n/a
3 TRCN0000476356 ACCTAACCGTGAAGTCACCGCACC pLX_317 24.4% 53% 53% V5 0_1ins651 n/a
Download CSV