Transcript: Human XM_017029616.2

PREDICTED: Homo sapiens BCL6 corepressor (BCOR), transcript variant X10, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
BCOR (54880)
Length:
6270
CDS:
92..5071

Additional Resources:

NCBI RefSeq record:
XM_017029616.2
NBCI Gene record:
BCOR (54880)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017029616.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000244243 ACGTGGGTGACCGATTCAAAT pLKO_005 3006 CDS 100% 13.200 18.480 N BCOR n/a
2 TRCN0000236074 CGCATCAAACCGGATTGTTTA pLKO_005 5994 3UTR 100% 13.200 18.480 N BCOR n/a
3 TRCN0000033459 CCCGCATATTTCGCTGCAATT pLKO.1 5169 3UTR 100% 10.800 15.120 N BCOR n/a
4 TRCN0000033461 CCACGAAACTTATACTTTCAA pLKO.1 2686 CDS 100% 5.625 7.875 N BCOR n/a
5 TRCN0000033463 CCCACAGTGAACTTATGGAAA pLKO.1 4800 CDS 100% 4.950 3.960 N BCOR n/a
6 TRCN0000236075 AGCAACCCAGAACCGAGTTTC pLKO_005 1949 CDS 100% 10.800 7.560 N BCOR n/a
7 TRCN0000033460 GCCAAATAAGTATTCACTGAA pLKO.1 718 CDS 100% 4.950 3.465 N BCOR n/a
8 TRCN0000033462 GCTCTATATTTCTGTCTCCAA pLKO.1 1998 CDS 100% 2.640 1.848 N BCOR n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017029616.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12102 pDONR223 100% 5.1% 5.1% None 1_4704del;4977_4978ins288 n/a
2 ccsbBroad304_12102 pLX_304 0% 5.1% 5.1% V5 1_4704del;4977_4978ins288 n/a
3 TRCN0000472582 ATCCCGCCTCTGCTGCTGACCAGA pLX_317 80.3% 5.1% 5.1% V5 1_4704del;4977_4978ins288 n/a
Download CSV