Transcript: Human XM_017029643.2

PREDICTED: Homo sapiens histone deacetylase 8 (HDAC8), transcript variant X10, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
HDAC8 (55869)
Length:
1735
CDS:
172..1197

Additional Resources:

NCBI RefSeq record:
XM_017029643.2
NBCI Gene record:
HDAC8 (55869)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017029643.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000314872 AGTCGCTGGTCCCGGTTTATA pLKO_005 320 CDS 100% 15.000 21.000 N HDAC8 n/a
2 TRCN0000197281 GCGTGTTTATGCAAGCAGTTT pLKO.1 1254 3UTR 100% 4.950 6.930 N HDAC8 n/a
3 TRCN0000004853 CCAATGCCTGATTGACGGAAT pLKO.1 654 CDS 100% 4.050 5.670 N HDAC8 n/a
4 TRCN0000314873 CTGAGGAGTGGTGCCTATAAT pLKO_005 1226 3UTR 100% 15.000 10.500 N HDAC8 n/a
5 TRCN0000314871 ATGTGCAAAGTAGCAATTAAC pLKO_005 673 CDS 100% 13.200 9.240 N HDAC8 n/a
6 TRCN0000004850 GCATTCTTTGATTGAAGCATA pLKO.1 408 CDS 100% 4.950 3.465 N HDAC8 n/a
7 TRCN0000004849 TGACAGAAAGAGATCAGGTTT pLKO.1 1199 3UTR 100% 4.950 3.465 N HDAC8 n/a
8 TRCN0000004852 CCGAATCCAACAAATCCTCAA pLKO.1 1065 CDS 100% 4.050 2.835 N HDAC8 n/a
9 TRCN0000195692 CACAGCATATGGTCCTGATTA pLKO.1 996 CDS 100% 0.000 0.000 N HDAC8 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017029643.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08602 pDONR223 100% 62.6% 62.1% None (many diffs) n/a
2 ccsbBroad304_08602 pLX_304 0% 62.6% 62.1% V5 (many diffs) n/a
3 TRCN0000467791 AACTATTCCCAAGCGGCTCTCGTG pLX_317 32.5% 62.6% 62.1% V5 (many diffs) n/a
Download CSV