Transcript: Human XM_017029787.2

PREDICTED: Homo sapiens Xg glycoprotein (Xg blood group) (XG), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
XG (7499)
Length:
3840
CDS:
1172..1720

Additional Resources:

NCBI RefSeq record:
XM_017029787.2
NBCI Gene record:
XG (7499)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017029787.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000118928 GCGGTGGAAATATCTACCCAA pLKO.1 1311 CDS 100% 2.640 3.696 N XG n/a
2 TRCN0000365436 GGGAGCAGCAGCCAGTTATTT pLKO_005 1645 CDS 100% 15.000 10.500 N XG n/a
3 TRCN0000365435 TCCCGACAGCGGTGGAAATAT pLKO_005 1303 CDS 100% 15.000 10.500 N XG n/a
4 TRCN0000365437 AGCTAGACCCTGCGTTCTAAA pLKO_005 1920 3UTR 100% 13.200 9.240 N XG n/a
5 TRCN0000365496 GGCAATCCAGAAGGCAATATG pLKO_005 1574 CDS 100% 13.200 9.240 N XG n/a
6 TRCN0000370548 GTGGTTATAAAGATAAGTTAG pLKO_005 1897 3UTR 100% 10.800 7.560 N XG n/a
7 TRCN0000118931 GCAGCCAGTTATTTCAAACTA pLKO.1 1652 CDS 100% 5.625 3.938 N XG n/a
8 TRCN0000118927 GCCATAAATATCAGAACCAAA pLKO.1 2721 3UTR 100% 4.950 3.465 N XG n/a
9 TRCN0000365438 CAAGAAGCCAAACTCAGATAT pLKO_005 1240 CDS 100% 13.200 7.920 N XG n/a
10 TRCN0000118930 AGAAGGCAATATGGTAGCAAA pLKO.1 1582 CDS 100% 4.950 2.970 N XG n/a
11 TRCN0000166364 CACACACACACACACACACAA pLKO.1 3142 3UTR 100% 4.950 2.475 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017029787.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07138 pDONR223 100% 92.1% 91.8% None 60_61ins42;212_214delGTA;353T>C n/a
2 ccsbBroad304_07138 pLX_304 0% 92.1% 91.8% V5 60_61ins42;212_214delGTA;353T>C n/a
3 ccsbBroadEn_01782 pDONR223 100% 85.2% 85.2% None 60_61ins42;334_378del n/a
4 ccsbBroad304_01782 pLX_304 0% 85.2% 85.2% V5 60_61ins42;334_378del n/a
5 TRCN0000470725 AGGCGAACGTTATCGCCGATGAGT pLX_317 86.9% 85.2% 85.2% V5 60_61ins42;334_378del n/a
Download CSV