Transcript: Human XM_017029883.2

PREDICTED: Homo sapiens zinc finger CCCH-type, RNA binding motif and serine/arginine rich 2 (ZRSR2), transcript variant X6, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ZRSR2 (8233)
Length:
4082
CDS:
523..1569

Additional Resources:

NCBI RefSeq record:
XM_017029883.2
NBCI Gene record:
ZRSR2 (8233)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017029883.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000230760 GGAGATAGATGTTCACGTAAA pLKO_005 658 CDS 100% 10.800 6.480 N ZRSR2 n/a
2 TRCN0000218765 CAACAGTTCCTAGACTTCTAT pLKO_005 808 CDS 100% 5.625 3.375 N ZRSR2 n/a
3 TRCN0000074629 CATGTTTACGACGTTTGGAAT pLKO.1 720 CDS 100% 4.950 2.970 N ZRSR2 n/a
4 TRCN0000074632 CCTTTGGGAAGAACTCCGAAA pLKO.1 1175 CDS 100% 4.050 2.430 N ZRSR2 n/a
5 TRCN0000074628 GACATCTACTTGTCTCCAGAT pLKO.1 1141 CDS 100% 4.050 2.430 N ZRSR2 n/a
6 TRCN0000074630 GCATGTTTACGACGTTTGGAA pLKO.1 719 CDS 100% 3.000 1.800 N ZRSR2 n/a
7 TRCN0000074631 ACCCGTGGATTTCAGAGTAAT pLKO.1 582 CDS 100% 13.200 6.600 Y ZRSR2 n/a
8 TRCN0000230759 ACCCGTGGATTTCAGAGTAAT pLKO_005 582 CDS 100% 13.200 6.600 Y ZRSR2 n/a
9 TRCN0000230761 TGGCGATTTGTGGTTTATTTG pLKO_005 1034 CDS 100% 13.200 6.600 Y ZRSR2 n/a
10 TRCN0000230762 TCTCACAAACGCACATCAAAG pLKO_005 1327 CDS 100% 10.800 5.400 Y ZRSR2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017029883.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01874 pDONR223 100% 68.3% 68.3% None (many diffs) n/a
2 ccsbBroad304_01874 pLX_304 0% 68.3% 68.3% V5 (many diffs) n/a
3 TRCN0000469030 TTCAGAGTCCTGCCAAGCCATAGG pLX_317 29.6% 68.3% 68.3% V5 (many diffs) n/a
4 ccsbBroadEn_07211 pDONR223 100% 68.3% 68.1% None (many diffs) n/a
5 ccsbBroad304_07211 pLX_304 0% 68.3% 68.1% V5 (many diffs) n/a
6 TRCN0000477197 TATGCCGATTGCCAAGTACATTTT pLX_317 21.9% 68.3% 68.1% V5 (many diffs) n/a
7 ccsbBroadEn_11210 pDONR223 100% 64.3% 62.1% None (many diffs) n/a
8 ccsbBroad304_11210 pLX_304 0% 64.3% 62.1% V5 (many diffs) n/a
9 TRCN0000480269 TAAGCGGTCAACCACGCGGAAGTT pLX_317 24.1% 64.3% 62.1% V5 (many diffs) n/a
Download CSV