Transcript: Human XM_017029893.2

PREDICTED: Homo sapiens sushi repeat containing protein X-linked (SRPX), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
SRPX (8406)
Length:
1386
CDS:
90..1349

Additional Resources:

NCBI RefSeq record:
XM_017029893.2
NBCI Gene record:
SRPX (8406)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017029893.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000083987 GCACTTGCAAATTTCGAGTTA pLKO.1 835 CDS 100% 4.950 6.930 N SRPX n/a
2 TRCN0000083984 CCTACTGATCTGCCAGTCAAA pLKO.1 386 CDS 100% 4.950 3.465 N SRPX n/a
3 TRCN0000083985 CCCAGAGAATGGTTACATGAA pLKO.1 890 CDS 100% 4.950 2.970 N SRPX n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017029893.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01922 pDONR223 100% 89% 87.5% None (many diffs) n/a
2 ccsbBroad304_01922 pLX_304 44.6% 89% 87.5% V5 (many diffs) n/a
3 TRCN0000479942 ACGGAATTTCCCAGGTCCCTTACA pLX_317 26.6% 89% 87.5% V5 (many diffs) n/a
Download CSV