Transcript: Human XM_017029977.1

PREDICTED: Homo sapiens phosphate cytidylyltransferase 1, choline, beta (PCYT1B), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
PCYT1B (9468)
Length:
5374
CDS:
347..1168

Additional Resources:

NCBI RefSeq record:
XM_017029977.1
NBCI Gene record:
PCYT1B (9468)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017029977.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000418941 GGTGGTGTTTGAAGGGTAATA pLKO_005 1237 3UTR 100% 13.200 18.480 N PCYT1B n/a
2 TRCN0000035683 CATCTCAACATCGGACATCAT pLKO.1 655 CDS 100% 4.950 6.930 N PCYT1B n/a
3 TRCN0000035681 GAACTGAATGTCAGCTTTATA pLKO.1 743 CDS 100% 15.000 10.500 N PCYT1B n/a
4 TRCN0000430435 TGTTCGTGACTATGATGTTTA pLKO_005 685 CDS 100% 13.200 9.240 N PCYT1B n/a
5 TRCN0000424458 TGCTACTTCTGCGTCCATAAG pLKO_005 1541 3UTR 100% 10.800 7.560 N PCYT1B n/a
6 TRCN0000035682 AGAGCCATGATCTAATTCAAA pLKO.1 867 CDS 100% 5.625 3.938 N PCYT1B n/a
7 TRCN0000111347 GCTACTTGTTGGTAGGAGTTT pLKO.1 375 CDS 100% 4.950 3.465 N Pcyt1b n/a
8 TRCN0000035680 GCTCATGATGACATTCCGTAT pLKO.1 557 CDS 100% 4.050 2.835 N PCYT1B n/a
9 TRCN0000035679 CCCAACAGCTACTTGTTGGTA pLKO.1 368 CDS 100% 0.300 0.210 N PCYT1B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017029977.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07421 pDONR223 100% 77.7% 77.7% None 0_1ins234 n/a
2 ccsbBroad304_07421 pLX_304 0% 77.7% 77.7% V5 0_1ins234 n/a
3 TRCN0000478025 GTACACCGCTTATTTCTGACAATA pLX_317 21.7% 77.7% 77.7% V5 0_1ins234 n/a
Download CSV