Transcript: Human XM_017030086.1

PREDICTED: Homo sapiens transducin beta like 1 Y-linked (TBL1Y), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
TBL1Y (90665)
Length:
2432
CDS:
637..2370

Additional Resources:

NCBI RefSeq record:
XM_017030086.1
NBCI Gene record:
TBL1Y (90665)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017030086.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000152203 CGTCCCAAGTAATAAAGATGT pLKO.1 1329 CDS 100% 4.950 6.930 N TBL1Y n/a
2 TRCN0000437446 GATGCATGCGTCCACGATCTT pLKO_005 1807 CDS 100% 4.950 6.930 N TBL1Y n/a
3 TRCN0000154186 CTTCGCTCTGAAATGGAACAA pLKO.1 1473 CDS 100% 4.950 3.960 N TBL1Y n/a
4 TRCN0000151254 GAACAGTGATGGAACACTATT pLKO.1 1365 CDS 100% 13.200 9.240 N TBL1Y n/a
5 TRCN0000152673 GCTCGTGTTGAGACATTGTAT pLKO.1 1290 CDS 100% 5.625 3.938 N TBL1Y n/a
6 TRCN0000156393 CAACCCAAACTCCAGCATCAT pLKO.1 1887 CDS 100% 4.950 2.970 N TBL1Y n/a
7 TRCN0000447285 CCACGAGTCTGAGGTGTTCAT pLKO_005 1167 CDS 100% 4.950 2.970 N TBL1Y n/a
8 TRCN0000157198 GCCTGTCTACAGTGTAGCTTT pLKO.1 1995 CDS 100% 4.950 2.970 N TBL1Y n/a
9 TRCN0000153227 GAGACTCAACTGCAAGGATAT pLKO.1 1232 CDS 100% 10.800 5.400 Y TBL1Y n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017030086.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04526 pDONR223 100% 90.2% 89.6% None (many diffs) n/a
2 ccsbBroad304_04526 pLX_304 0% 90.2% 89.6% V5 (many diffs) n/a
3 TRCN0000466084 ACACCCCAAGATTCCCCTAAGATG pLX_317 20.9% 90.2% 89.6% V5 (many diffs) n/a
Download CSV