Transcript: Human XM_017030170.1

PREDICTED: Homo sapiens proline dehydrogenase 1, mitochondrial (LOC102724788), transcript variant X8, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
LOC102724788 (102724788)
Length:
1957
CDS:
394..1563

Additional Resources:

NCBI RefSeq record:
XM_017030170.1
NBCI Gene record:
LOC102724788 (102724788)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017030170.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000425304 ATGACGGCTTCATAGCCATTA pLKO_005 440 CDS 100% 10.800 5.400 Y PRODH n/a
2 TRCN0000026577 GAGGTGCTTCTTTCACCAAAT pLKO.1 522 CDS 100% 10.800 5.400 Y PRODH n/a
3 TRCN0000026542 GCAGGAAAGTGTCGCAAAGTT pLKO.1 606 CDS 100% 5.625 2.813 Y PRODH n/a
4 TRCN0000036692 GCGGAAGTTCAATGTGGAGAA pLKO.1 954 CDS 100% 4.050 2.025 Y LOC400889 n/a
5 TRCN0000026522 GTGTACAAGTACGTGCCCTAT pLKO.1 1393 CDS 100% 4.050 2.025 Y PRODH n/a
6 TRCN0000026533 CCGCACCTACTTCTACGCCAA pLKO.1 351 5UTR 100% 0.720 0.360 Y PRODH n/a
7 TRCN0000036693 GCAGGAAAGTGTCGCAAAGAT pLKO.1 606 CDS 100% 5.625 2.813 Y LOC400889 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017030170.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06779 pDONR223 100% 78.7% 78.8% None (many diffs) n/a
2 ccsbBroad304_06779 pLX_304 0% 78.7% 78.8% V5 (many diffs) n/a
3 TRCN0000492052 CGACCCACTTGCTACGAGTGGATC pLX_317 29.3% 78.7% 78.8% V5 (many diffs) n/a
Download CSV