Transcript: Human XM_017030181.2

PREDICTED: Homo sapiens ADP-ribosylation factor-like protein 17 (LOC107984156), transcript variant X17, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
LOC107984156 (107984156)
Length:
542
CDS:
222..488

Additional Resources:

NCBI RefSeq record:
XM_017030181.2
NBCI Gene record:
LOC107984156 (107984156)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017030181.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000344420 GTGTGGAGACAGTAGAATATA pLKO_005 376 CDS 100% 15.000 7.500 Y ARL17B n/a
2 TRCN0000353088 CAGACCTCTGTGGCAGCATTT pLKO_005 443 CDS 100% 10.800 5.400 Y ARL17B n/a
3 TRCN0000263038 CGGATTCTTATATTGAGTTTG pLKO_005 276 CDS 100% 10.800 5.400 Y ARL17B n/a
4 TRCN0000140294 GATGTTGGCAGCCACTTCAAA pLKO.1 420 CDS 100% 5.625 2.813 Y ARL17A n/a
5 TRCN0000141827 GAGTTTGGATACAGCTGGAAA pLKO.1 290 CDS 100% 4.950 2.475 Y ARL17A n/a
6 TRCN0000371107 TGCCGTCCCTACAGTAGGTTT pLKO_005 353 CDS 100% 4.950 2.475 Y ARL17B n/a
7 TRCN0000140324 CAGTAGGTTTCTGTGTGGAGA pLKO.1 364 CDS 100% 2.640 1.320 Y ARL17A n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017030181.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000491281 ACTAATCGTCTACCCTGAGCTCTT pLX_317 73.6% 85.1% 83.4% V5 (not translated due to prior stop codon) 191G>C;260_261insTAAAGATTA;264_265ins36 n/a
2 ccsbBroadEn_11975 pDONR223 100% 39.5% 38.9% None (many diffs) n/a
3 ccsbBroad304_11975 pLX_304 0% 39.5% 38.9% V5 (many diffs) n/a
4 TRCN0000472181 ATTATGTTATCGCGATTGCCACTT pLX_317 93.6% 39.5% 38.9% V5 (many diffs) n/a
Download CSV