Transcript: Human XM_017030316.2

PREDICTED: Homo sapiens putative golgin subfamily A member 8I (LOC101930434), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
LOC101930434 (101930434)
Length:
2206
CDS:
1557..2066

Additional Resources:

NCBI RefSeq record:
XM_017030316.2
NBCI Gene record:
LOC101930434 (101930434)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017030316.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000157310 CAGCGCATAAGTCTCCTGAAT pLKO.1 1356 5UTR 100% 4.950 2.475 Y GOLGA8G n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017030316.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_16170 pDONR223 0% 33.7% 29.1% None (many diffs) n/a
2 ccsbBroad304_16170 pLX_304 0% 33.7% 29.1% V5 (many diffs) n/a
3 ccsbBroadEn_10341 pDONR223 100% 33.1% 28% None (many diffs) n/a
4 ccsbBroad304_10341 pLX_304 0% 33.1% 28% V5 (many diffs) n/a
5 TRCN0000476380 AGTGATAACGTTCAAGGTCGCGGA pLX_317 28.7% 33.1% 28% V5 (many diffs) n/a
Download CSV