Transcript: Mouse XM_017312341.1

PREDICTED: Mus musculus exportin 6 (Xpo6), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Xpo6 (74204)
Length:
4612
CDS:
619..4041

Additional Resources:

NCBI RefSeq record:
XM_017312341.1
NBCI Gene record:
Xpo6 (74204)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017312341.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000370925 TTGGACTATCTGACAAGTAAA pLKO_005 1936 CDS 100% 13.200 9.240 N XPO6 n/a
2 TRCN0000105441 CCCATGTTCTACCATGACTTT pLKO.1 985 CDS 100% 4.950 3.465 N Xpo6 n/a
3 TRCN0000324567 CCCATGTTCTACCATGACTTT pLKO_005 985 CDS 100% 4.950 3.465 N Xpo6 n/a
4 TRCN0000105440 GCCCAGGAGAAATTCGACATT pLKO.1 4432 3UTR 100% 4.950 3.465 N Xpo6 n/a
5 TRCN0000324566 GCCCAGGAGAAATTCGACATT pLKO_005 4432 3UTR 100% 4.950 3.465 N Xpo6 n/a
6 TRCN0000105443 GCCCATGTTCTACCATGACTT pLKO.1 984 CDS 100% 4.950 3.465 N Xpo6 n/a
7 TRCN0000105442 CCAGTTCTTCAGGACAATTTA pLKO.1 2203 CDS 100% 15.000 9.000 N Xpo6 n/a
8 TRCN0000324568 CCAGTTCTTCAGGACAATTTA pLKO_005 2203 CDS 100% 15.000 9.000 N Xpo6 n/a
9 TRCN0000370989 CCACCAAGTCTCGACAGATTT pLKO_005 3071 CDS 100% 13.200 18.480 N XPO6 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017312341.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11697 pDONR223 100% 66.4% 71.7% None (many diffs) n/a
2 ccsbBroad304_11697 pLX_304 0% 66.4% 71.7% V5 (many diffs) n/a
3 TRCN0000474235 CATAAAATAATGCTTTTCGGCGGA pLX_317 21.2% 66.4% 71.7% V5 (many diffs) n/a
Download CSV