Transcript: Mouse XM_017312662.1

PREDICTED: Mus musculus Werner syndrome homolog (human) (Wrn), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Wrn (22427)
Length:
6552
CDS:
382..4587

Additional Resources:

NCBI RefSeq record:
XM_017312662.1
NBCI Gene record:
Wrn (22427)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017312662.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000348623 TCGAGCCATAGAGTCTTTAAT pLKO_005 4701 3UTR 100% 15.000 21.000 N Wrn n/a
2 TRCN0000348621 GAATTGGGATTCCGATCTTAT pLKO_005 3209 CDS 100% 13.200 18.480 N Wrn n/a
3 TRCN0000071013 CGGCCAAATCTGTACTTAGAA pLKO.1 2467 CDS 100% 5.625 7.875 N Wrn n/a
4 TRCN0000071017 CGACGAATCATCTTGTCCCAT pLKO.1 3004 CDS 100% 2.640 3.696 N Wrn n/a
5 TRCN0000071015 CGATCTTATTTCTCCGAGGAT pLKO.1 3221 CDS 100% 2.640 2.112 N Wrn n/a
6 TRCN0000071014 CCCTCCCATCAACTCAGATAT pLKO.1 4242 CDS 100% 13.200 9.240 N Wrn n/a
7 TRCN0000335585 CCCTCCCATCAACTCAGATAT pLKO_005 4242 CDS 100% 13.200 9.240 N Wrn n/a
8 TRCN0000348556 GGCCGTCACATACACTCTATT pLKO_005 4053 CDS 100% 13.200 9.240 N Wrn n/a
9 TRCN0000071016 GCAAGGCAGAAACACGCTAAT pLKO.1 3763 CDS 100% 10.800 7.560 N Wrn n/a
10 TRCN0000335501 GCAAGGCAGAAACACGCTAAT pLKO_005 3763 CDS 100% 10.800 7.560 N Wrn n/a
11 TRCN0000166364 CACACACACACACACACACAA pLKO.1 6301 3UTR 100% 4.950 2.475 Y KAAG1 n/a
12 TRCN0000172440 CACACACACACACACAGACAA pLKO.1 6329 3UTR 100% 4.950 2.475 Y LINC00955 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017312662.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.