Transcript: Mouse XM_017312677.1

PREDICTED: Mus musculus Wolf-Hirschhorn syndrome candidate 1-like 1 (human) (Whsc1l1), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Nsd3 (234135)
Length:
10138
CDS:
531..4871

Additional Resources:

NCBI RefSeq record:
XM_017312677.1
NBCI Gene record:
Nsd3 (234135)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017312677.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000233558 AGAGTAGAGCAGTACACTTTC pLKO_005 1716 CDS 100% 10.800 15.120 N Nsd3 n/a
2 TRCN0000080719 CTCCTCAAGAACCTATACTTT pLKO.1 6297 3UTR 100% 5.625 7.875 N Plpp5 n/a
3 TRCN0000233555 AGCAACCACCTCAACTCATTG pLKO_005 580 CDS 100% 10.800 8.640 N Nsd3 n/a
4 TRCN0000233556 ACCAAATACCCGCCATATAAT pLKO_005 780 CDS 100% 15.000 10.500 N Nsd3 n/a
5 TRCN0000233557 TTTAGCCCTACTGACTATTAC pLKO_005 846 CDS 100% 13.200 9.240 N Nsd3 n/a
6 TRCN0000015617 GCAGGGAATTGTTTGAGTCTT pLKO.1 1051 CDS 100% 4.950 2.970 N NSD3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017312677.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_15875 pDONR223 0% 39.6% 40% None (many diffs) n/a
2 ccsbBroad304_15875 pLX_304 0% 39.6% 40% V5 (many diffs) n/a
3 TRCN0000480318 ACTCGGGTCACATCCTCTCAATCT pLX_317 24.3% 39.6% 40% V5 (many diffs) n/a
Download CSV