Transcript: Mouse XM_017312738.1

PREDICTED: Mus musculus CLIP associating protein 1 (Clasp1), transcript variant X12, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Clasp1 (76707)
Length:
7846
CDS:
744..5378

Additional Resources:

NCBI RefSeq record:
XM_017312738.1
NBCI Gene record:
Clasp1 (76707)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017312738.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000113933 CCTGAATTTACCATGTTACTT pLKO.1 3927 CDS 100% 5.625 7.875 N CLASP1 n/a
2 TRCN0000265376 CCATTATGCCAACTATCTTTA pLKO_005 1969 CDS 100% 13.200 10.560 N Clasp1 n/a
3 TRCN0000253373 AGATTGGAACCAGACTTATAT pLKO_005 6013 3UTR 100% 15.000 10.500 N Clasp1 n/a
4 TRCN0000253372 CCGAAGCCAGGAGGATCTAAA pLKO_005 4343 CDS 100% 13.200 9.240 N Clasp1 n/a
5 TRCN0000113932 GCAGAGAGTAAATGCTCTAAA pLKO.1 1760 CDS 100% 13.200 9.240 N CLASP1 n/a
6 TRCN0000265397 TTGGGTGAACTCTAGCAATTA pLKO_005 914 CDS 100% 13.200 9.240 N Clasp1 n/a
7 TRCN0000113935 CCAAGTCTAATAGACAGACTA pLKO.1 1023 CDS 100% 0.495 0.347 N CLASP1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017312738.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11720 pDONR223 100% 8.6% 9.5% None (many diffs) n/a
2 ccsbBroad304_11720 pLX_304 0% 8.6% 9.5% V5 (many diffs) n/a
3 TRCN0000474886 TTTTTTTCCCTTTGGCCTCGACAC pLX_317 89% 8.6% 9.5% V5 (many diffs) n/a
Download CSV