Transcript: Mouse XM_017312785.1

PREDICTED: Mus musculus discs, large (Drosophila) homolog-associated protein 2 (Dlgap2), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Dlgap2 (244310)
Length:
7377
CDS:
2292..5459

Additional Resources:

NCBI RefSeq record:
XM_017312785.1
NBCI Gene record:
Dlgap2 (244310)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017312785.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000089477 CGATGAATGTATTCCCGTGAT pLKO.1 4037 CDS 100% 4.050 3.240 N Dlgap2 n/a
2 TRCN0000089473 CCTAGCTTTCACTTTGTTATT pLKO.1 5735 3UTR 100% 13.200 9.240 N Dlgap2 n/a
3 TRCN0000089475 GCTCAATGACTGGAAGATAAT pLKO.1 5201 CDS 100% 13.200 9.240 N Dlgap2 n/a
4 TRCN0000089476 CCCAGGAACATGAAAGGGTTA pLKO.1 2508 CDS 100% 4.050 2.835 N Dlgap2 n/a
5 TRCN0000089474 CCCATCATACAAAGACCACTT pLKO.1 3696 CDS 100% 4.050 2.835 N Dlgap2 n/a
6 TRCN0000166364 CACACACACACACACACACAA pLKO.1 909 5UTR 100% 4.950 2.475 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017312785.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02114 pDONR223 100% 76.4% 82.5% None (many diffs) n/a
2 ccsbBroad304_02114 pLX_304 0% 76.4% 82.5% V5 (many diffs) n/a
3 TRCN0000478929 GGTGAATCGTCTTCGATGACGGTC pLX_317 9.7% 76.4% 82.5% V5 (many diffs) n/a
Download CSV