Transcript: Mouse XM_017312865.1

PREDICTED: Mus musculus ring finger protein 150 (Rnf150), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Rnf150 (330812)
Length:
10058
CDS:
997..2349

Additional Resources:

NCBI RefSeq record:
XM_017312865.1
NBCI Gene record:
Rnf150 (330812)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017312865.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000086847 CTTCGTGAACATCACCTATTT pLKO.1 1122 CDS 100% 13.200 9.240 N Rnf150 n/a
2 TRCN0000086844 CTGCACGTACAGGGATAAGAT pLKO.1 1368 CDS 100% 5.625 3.938 N Rnf150 n/a
3 TRCN0000086846 GCCTTCGTGAACATCACCTAT pLKO.1 1120 CDS 100% 4.950 3.465 N Rnf150 n/a
4 TRCN0000086845 CTCCAACACAAACGAGACCAT pLKO.1 1440 CDS 100% 2.640 1.848 N Rnf150 n/a
5 TRCN0000166364 CACACACACACACACACACAA pLKO.1 346 5UTR 100% 4.950 2.475 Y KAAG1 n/a
6 TRCN0000162548 CACACACACACACACAAATAT pLKO.1 350 5UTR 100% 15.000 7.500 Y KAAG1 n/a
7 TRCN0000163739 GAAGAAGAGGAAGAGGAGGAA pLKO.1 7658 3UTR 100% 2.640 1.320 Y CCDC88B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017312865.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12349 pDONR223 100% 64.1% 66.2% None (many diffs) n/a
2 ccsbBroad304_12349 pLX_304 0% 64.1% 66.2% V5 (many diffs) n/a
3 TRCN0000473506 ACCCAGGCTATCAGGATCTATATA pLX_317 48.1% 64.1% 66.2% V5 (many diffs) n/a
Download CSV