Transcript: Mouse XM_017313228.1

PREDICTED: Mus musculus sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3F (Sema3f), transcript variant X3, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Sema3f (20350)
Length:
3901
CDS:
614..2971

Additional Resources:

NCBI RefSeq record:
XM_017313228.1
NBCI Gene record:
Sema3f (20350)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017313228.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000054577 GCAGAGCGCAATGACGATAAA pLKO.1 1415 CDS 100% 13.200 18.480 N Sema3f n/a
2 TRCN0000054574 CGACTGTCATTCAAAGAACTT pLKO.1 710 CDS 100% 4.950 6.930 N Sema3f n/a
3 TRCN0000054573 CCAGTCATTTATGCTGTCTTT pLKO.1 1670 CDS 100% 4.950 3.960 N Sema3f n/a
4 TRCN0000054576 CCTCATCAATGAGGAACTCTA pLKO.1 1249 CDS 100% 0.495 0.347 N Sema3f n/a
5 TRCN0000373485 TCTACTCCATGGCTGATATTC pLKO_005 1731 CDS 100% 13.200 9.240 N SEMA3F n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017313228.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06931 pDONR223 100% 89% 95.9% None (many diffs) n/a
Download CSV